GenePrediction:GLEAN_4122 Details

Name: GLEAN_4122
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2927059..2928784 (+ strand)
Length: 1726
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2927059..2927130 (+ strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_113:2927201..2927336 (+ strand)
Length: 136
Type: CDS
Source: GLEAN
Position: GCSC_113:2927395..2927578 (+ strand)
Length: 184
Type: CDS
Source: GLEAN
Position: GCSC_113:2927640..2928382 (+ strand)
Length: 743
Type: CDS
Source: GLEAN
Position: GCSC_113:2928450..2928784 (+ strand)
Length: 335
>GLEAN_4122 class=GenePrediction position=GCSC_113:2927059..2928784 (+ strand)
ATGAGCGGCCTCGCGACCAAGCAGCAGTCGCTCAAGATCTTCGAGAAGCTCAAGTCCAAGCCGGCCAACAAGGTAGCCCT
CAACCCGTCCAGATTGCCGGTCACCACCCTCCCCTCGCGGGCCGGATGCTAAGCGTTGCCAGGTCTGCTTCGACTGCGGC
CAGAAGAACCCCACGTGGACATCGGTGCCTTTTGGTATCTACCTCTGTCTGGACTGCTCCGCCAACCACCGCAACCTCGG
GGTGCACATCTCGTTTGTCCGCTCGACCAATCTCGACCGTACGTGTTTTGCTTTGTTTTGTTGTGTTGCGGCCGAGGCTG
ACCGGGAGGGGATCAGAATGGCAATGGGACCAGCTGCGGGTCATGAAGGTGGGCGGTAACGAGTCCGCGACCAAGTTCTT
CCAGCAGAACGGCGGCTCAGCAGCCCTTAACAGCAAGGACTCCAAGACGAAGTACCAGTCTGCTGCTGCCACCAAGTATA
AGGAGGAGCTGAAGAAGCGGGCGGCACGCGATGCCAAGGAGTAAGATGCCCTTGTTCTCCGTTCCGTCTTTGTCTGCTTG
CTGACTGCTCACGCCTGCCAGGTATCCCGAAGAGGTCATCGTCGACGGGGATGTTTCAGAGGCGTCCAAAACCCCGTCCG
GCGAGGCCGAGGACGACTTCTTTTCCTCCTGGGACAAGCCCAGCATCAAGAAGCCCACGCCACCCATTTCCCGCACCGCC
ACGCCGCCCGTGGTCGGCCGCACGCCATCGCCATTTCTCAGTGCCGGCGGCAAGGATAGCATATCACGATCGACGTCACC
GCTGGCTGGCAACAGTTCCGACACGTCCAGCGTGGCGAAGCCGGCCGCCAGCCGCATCACGCACTCGGCCGCGCTCAAGA
AGACGACCCTCGGCGGTGGTGCCCGGAAGGCCAACGTGCTGGGGGCCAAGAAAGCGCCGAAGCTCGGCGTCAAAAAAGTC
ACGGTCGACCTGATCGACTTTGACGAGGCTGAGAAGAAGGCTAAGGAGGAGGCCGAGCGGATCGAGAAGCTGGGCTACGA
CCCGGATGGCGAGGAGGAGTCGGCTGCATCGGCTGTCAAGGCTGCTAGTGCCAAGTCGGGTGCAACCACGATTGTGTCGC
CGACGCCCGTCAATGCTACACGCGGAGCGGCATCGCACAGCCGGGAGAAGTCGGCGTCGGAGATGGAGCGGCTGGGCATG
GGCATGGGCCGGTTAGGATTCGGCCAGGTGGGCGGACGTGGCGGCGCAGCTGCGGCCTCGTCGTCAGCGGGAAAGAGGAA
CATGGGAGGCTTCGGGTCCGTGGGCCCGATCAAGTCCTCTGACGGTAAGCTTTGTTTGTGCGCATTCTTGTCCAGATCAC
GTGACGCTAACCGCAGCTTGACGCTTCTCAGACGACGAAAAGTTTGCCCGCAGCAAGTTTGGCAACCAAAAGGCCATCTC
GTCGGACGAGTATTTTGGCAAGGGCACGTACGACTCGGCCGTGCAGAACGAGGCAAAGCAGCGGCTGCAGGGCTTCGAGG
GGGCCACGTCGATCTCGTCCAACGCGTACTTTGGCCGGCCGGACGAGGAGGCGGAGGAGGAATACGGCGACCTGGAGTCG
GCAGCCAAGGATTTTGTGCGCAAGTTTGGCATCACAGCCGGCGACGACCTCGACAACCTGACGCATGCGTTGGGTGCCGG
CGCGACGAAGCTGCAAGGAGCAATCCGGAATTACCTGGGCAACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62