GenePrediction:GLEAN_4123 Details

Name: GLEAN_4123
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2930828..2932838 (+ strand)
Length: 2011
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2930828..2930992 (+ strand)
Length: 165
Type: CDS
Source: GLEAN
Position: GCSC_113:2931192..2932838 (+ strand)
Length: 1647
>GLEAN_4123 class=GenePrediction position=GCSC_113:2930828..2932838 (+ strand)
ATGCTGGCGAATGCCGAGGTCGCGCAGGGCAGCTGGCAGCTGGACAGCTACTATGTAGCCACAGCAAGGCCCAGAACAGC
GCTAAGCCAAAGCGCAGTGGGCCACCCGCCCAGAGTCCGGGGGATGAGGGGGAAGGCAGCCTGTGCCGAGGCATGGCTGC
GACGGGTTAGTGCATACTAGGTATAACGTAAGCGCATGAGGTGTGGGCAGCTGAGTATCATGTGACGTGTTGCACAAGGG
CAGAAGCGACCAATCAGGGAACGGCATCGGCTCTCACAAAGTACTTTTTTTTTTTTGGTCATTGACCTGTAGTAGTTGAC
TGTCTGTCTGCGGCGACGCTGTAGCCACACAACCCTGCACCCAGACGCACCGTGGCAGCTGCGCCATGACGGCAGTGGTC
TCTCTTGCTGCTGCAGCTGCTGCTTCTGTGCGATCGACGACGACCTGCCGGCTGACACGGCTGCTTGGCGTGTATTCGGC
AGCGCCGGCCTCGCCGCAGCGACGACTGCGGCAGCAGCGCGTGTCTAGGATGGCGATGCAATCGGCGGCCATAGCGACAT
GGCCGCTGTCGGCCCCATGCTGTCAGTCGGGGCTGAAGCAGCACCAGCCCCCGGGCAAAGTGAAGGCATACATTGCCCTA
GGCAGCAACATGGGCGACCGGATCGGATGGATCGAGAAGGCCTGCACGGAGATGGACAGGCGTGGACTGCGGGTGTGTCG
CACCAGCAGTCTGTGGGAGACGGAGCCGATGTACGTGCTGGAGCAGGACAAATTTGCCAATGGGGTATGCGAGGTGGAGA
CGGAACTGGCACCGCTGGCCCTGCTGGACGAGCTGCAGGACATTGAGCGCAGCTTGGGACGGCGCAAGCTGGTGGACAAG
GGGCCGCGCAACATTGATCTGGACATTTTGCTGTACGGCGACGAGAAGATTGAAGACGAGCGGCTGACGGTGCCGCACAT
CGGCATGGCAGAGCGGGAGTTTGTGCTGCGGCCGTTGGTACAGCTGGCGCCGGGCATTGCGTTGGACCCAGCCCGGCCGT
GGAAGCTGGCGCAGGACTACCTGAACGAGTTGGCGGTGGTGGCGGGAAGCGAGCCGTTGACGCCGCTGACACCGTTGGGG
ACGGCGGAGACGACGAGAGAGCCGCTGCAGGCGCTGCGATCGTCGCGGCGGACACGGGTGATGGCGATCCTGAACGTGAC
GCCAGACTCCTTCTCCGACGGCGGACGACACGCGGCGACGAGCGAGACGGCACTAGATGCGCTGGCCGAGACGGTGCGCG
GCTTTGTGCGGGACGGCGCAGCCGTGATTGACGTTGGCGGACAGTCGACGGCGCCAGGGCGGCCAGAGGTGTCGGTCGAG
GAGGAGCTGGCGCGCGTGGTGCCGGCAGTGGCGCGGATTCGACAGGAACATGCAGCCGACGTGGTGGCCATCAGCGTGGA
CACGTACCGGGCAGCTGTGGCTGAGGCGGCCGTGGCAGCCGGTGCCGACATGATCAACGACGTGTCGGCCGGCGACATGG
ACGCCGACATGCTGCCGACCGTCGCTCGGCTGGGCGCTACTGTCTGTCTGATGCACATGCGCGGCACGCCTGCCACCATG
AGCACGCTCAACGACTATGGCGGCCGCCCGTCTGCCATGGTGGCTGCTGTGGCCCGTGAGCTGCTGGCCCGCGTCGCTGC
AGCCGAGGCGGCTGGTATCCGTCGCTGGCGCATCGTGCTCGATCCCGGACTCGGCTTCGCCAAGGTCGGCGACCAGAACA
TTGACGTGCTGCGCCACCTGGCCGAGCTGCGGGCTTGGCCCGGCCTCGAGGGACTGCCGTGGCTCGTTGGCTCTAGCCGC
AAGAGCTTTATCGGCCGTACCACCGGCGTTGCTACACCGGCTGAACGCGTCTGGGGCACGGCAGCTACGGTGGCGGCGGC
TGTGCAGGGCGGCGCCGACATTGTGCGGGTGCACGACGTGCGTGAGATGGCGCAGGTGGTGGCGATGGCAGATGCCATCT
GGCGGTATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62