GenePrediction:GLEAN_4128 Details

Name: GLEAN_4128
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2947894..2948726 (+ strand)
Length: 833
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2947894..2948032 (+ strand)
Length: 139
Type: CDS
Source: GLEAN
Position: GCSC_113:2948086..2948726 (+ strand)
Length: 641
>GLEAN_4128 class=GenePrediction position=GCSC_113:2947894..2948726 (+ strand)
ATGTTTATTGTGCCCGATGCAGCCGTGGCTGCAGCTGTGGGCATGTCCGGCGGTGTCCTAGCTGCAGCCAAGAAGCAGCT
GCGCCACCAGATGAAACAGCGGCTGGCCGCCCTGCCGTCAGCGTCTGTCGACCAGCAGAGTGAGCCTCCCTCCCCTTGAC
AACGTCCCATTGCATGTCTGACTCTGGCCTAGGTTCCGCCATCTTCAGCGCCCTTGCCGCCTTTCCGCCCTATCGGCACG
CCCGTCGCGTGGCCGTCTTCCTGTCGATGCCCGCCGCCGAGGTCCAGACTGACGCCATCGTGCGCCACGCCCTGGCTGCC
GGTAAGCAGGTCTTTGTGCCGTATCTGCACAAGCCCGGTTCCCATCTGGCGGCCACCGGACTGCAGCAACCGCCGCCGGC
CCGGGTCATGGACATGGTCCGGCTACACGACTGTGCTGACTACGAGTCGCTGCTACCCGACCGCTGGGGCATCCCCAGCG
TCTCTCCGGCCAGCGTGCCCAACCGGTCTCGTATCCTCGGAGACGGAGACGGAGACGCCCCAGTAGCGGCACGCGCCCTC
GACCTCGACCTCATCCTCATGCCCGGTGTCGCCTTTGACGTCGATCCCGCCTCCGGCCGCATTCGCCGCTGCGGCCACGG
ACGGGGCTTCTACGACTACTTTCTGCACCGCTATGCCTCGGCCGTGTCGCCAGCCGTCCATCTCTGCGGCCTTGCCCTCT
CCGAGCAGATCCTACCTAACCATGCCGACAAAGCGGTGCCAACGGGCCCCCACGATAAGCCGCTAGACAGTCTCATCACT
GGAGCCGGTACCATCGTAACATCGCTGGGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62