GenePrediction:GLEAN_4129 Details

Name: GLEAN_4129
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2949434..2952740 (+ strand)
Length: 3307
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2949434..2949562 (+ strand)
Length: 129
Type: CDS
Source: GLEAN
Position: GCSC_113:2949627..2949716 (+ strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_113:2949850..2950131 (+ strand)
Length: 282
Type: CDS
Source: GLEAN
Position: GCSC_113:2950200..2950290 (+ strand)
Length: 91
Type: CDS
Source: GLEAN
Position: GCSC_113:2950358..2951647 (+ strand)
Length: 1290
Type: CDS
Source: GLEAN
Position: GCSC_113:2951701..2952740 (+ strand)
Length: 1040
>GLEAN_4129 class=GenePrediction position=GCSC_113:2949434..2952740 (+ strand)
ATGGCCTCTGAGAGCGCCGCAGAGGTGTTCTCGCCACAAAATGTCCTCGCCGGCATGGTCACAATGCGGGGCCACGACGC
CTCCAAGAAGAAGGCCGCCATGGACTATCTTGCCAAGTTCCAGAAATCGGTTTGTTCTCCTCTGTCTCCCGGGGATGCTT
CACCGTGCTCCGTGATGGCTAACAGCCCCCCAGGAGAGCGCCTGGTCTGTCACAATTACAATCCTTCAGTCTTCCGTCGA
GGCAGAAGCCATGCTGTTCGCTGCGACAACATTGAAGGGCAAGGTAGCGACACTGCCCCTCCCCCTCTCCTGACGAGCAA
GCGAGCAGTTCTCATCACCGTCACCCTGCTCCTCATGCCCGGATTTCTCTTGCCAGCAGAAATAAGCTCAGCTCCGCGTC
TAACGTAACTCGCCAGATCACATTTGACCTCACCACTCAGGTCCGGCCGGACGACCTCCCCGGGTTGCGCAACCAGATTC
TCCTGCTGCTAAAGAAATTTGCCCCTGGCCCACGACCTGTGCGCATCCAGCTGTGTGTGTGTCTTGCCATCCTGGCTATA
CAGATGACCGAGTGGAAGGATGTCCTCGCCACCGTTGTCTCTGCCCTGGGCAGCGACGTGGAGAGCCACGCCTGCATTCT
CGACTTCTTGCGCGTCCTACCCGAGGAGGTCACCGAAGGTCGCAAGATCACCCTCTCCGTACGTTAGGAGCTGTCGTCGT
CATTGTTGTGATGGTGGTTGCGATCATGTTGCTGACGTAAGCACAGGAAGAAGAGCTGGCCGATCGAACACGAGAGCTAC
TTGGCGACAACGCCGAGCAGGTCATCCAGCTACTCACCTCTTATGCCCAGTCATCTCGTGCGTTCTCTCTCCGCTCTTCG
TCGAGCCTGTATCCTCTTCCCTCCATTTCGCTAACGCCATGCAGCCGCCGCCGCCAAGAATCCTCTTTTGCTAGAATGCA
TCACCTCTTGGCTTCGGGAAGTCCCTGTAAACACCATTGTCAACTCCCCGCTACTCAACGTCATCATTTCGGCCATTGGG
AGCGATGACTCCATCCAGGCTGCTGCCGACTGTCTGGGCTCGCTCTGCCGGGAAACGAGGGACGTTGATGACAATCTCGA
GACCATCCAGGCCCTGCTTCCGCGCATCATCGAGCTTCGGCCGAACATTCGCAGGTTCGCTGAGGATGAGGACAAGGAGT
GCTTCAAGTCTCTGACGCTGCTCTTTGCGGATGCTGGCGATTCGTGGGTTGTGGCGATTGCCCGTGAACCCATCCATTTC
CGCCCTCTTGTCGATGCGCTGTTGGAGTGTGCAGCTTTGGACAAGGAGTGTGACGTGATCCGCTATACGTTTGGATTTTG
GTACGAGCTGAAGCAGTATCTGGTGCTGGAACGCTACATTGAGTCTCGTCTCCAGCTCGTCGATGTCTATTCGAAGCTTG
TTGACATCCTGCTGCAGCGCTTGCAGTACCCTCCCTCCGAAACTGGCGATGATACCGTCACGGACCTATTTGACGGCGAT
CGAGAGCAGGAAGAAAAGTTTCGCGAGTTCCGCCACCACATGGGCGACACGCTGAAAGACGCTTGTGAGGTTATGGGCGT
CACTGAGTGTCTGACTAAAGTTCTCAATGCCATTAGGATCTGGATGCAGACGTACGCTTCGCAGGTGTCAGCTACTTCGG
TACCACACTGGCAGGAGCTTGAGGCCCCCTTGTTTTCCATGCGAGCACTCGGCCGCATGGTCGGCAAGAAGGAGGAGTCC
GTGCTGCCGCAACTTATGCCACTCCTGGTGCAGATTCCGAACCACGAGAAGCTCCGATTTGCCACCATCATGGTCTTTGG
GCGCTACACCGAGTGGACGACAGCTCACCCGACCTTCCTCGAGCCGCAGTTCAACTTTATCGTGTCCTCCTTCCAGAGCG
AATCGAAGGAGATCATCCGCGCGGCTGCCCAAGCAATCAAGTTCTTCTGCACGGACTGCCGAGAGCTGTTGAGCGGCCAG
GTGGTGCAGATGCAGCAATTCTACGACCAGATTTTGGACAAGCTCCCGGAGATGAGCCAGGAGGAGATGACCGAGGGCGT
GGCCAGCGTCGTTGCCGTACAGGACCCCGGCGACGTCTACAAGCTGCTTAAGCTGTACTGCGATCCTCTGATCGAGCGCC
TGATGCGCAAAGCCAATGCCGCCACGACCGAGGGAGGCAAATTGGCTGTTGCAGGTGAGTTTGCTTGCGCAAACCAACGA
AAGAATCAGAATGCTGACGTACTGCAGACCACTTGCAATTGATCACGATCTTTGTGCAGAACGTGATACCATCGGTGCCC
AAAGGCCAGGAGAACCCGGCGGTCAAGTACTGGAGCGAGGTGTTCCACGTGCTCTCGACGGTGCTGGAAAACTTCCTCAA
CTTCACACCGATCTGCGAGCGTGTCTGCCGGTGTTGGCGGTTTATGATCATCTCGTACCGCACGGACATGACACCGCTGC
TAGCGGCCATGGCCAACAAGCTGGCGGAGGGATTTACAGTGTCAAAGCAAGGATGTTTCCTCTGGGTAACGGGGGCGATT
TTGCGCGAATTTTCGGAAAATCGCGAGCACGTGGAGGCACAGATCACGGAGTCGATCTACGTGTTCTTCGAGTCGCAGGC
AACGAGCGTGCTGCGCGTGATGAGCGCCCTGCCACCAGCCGAGCTTCCGGACGTGATCGAGGACTTCTTCCGGCTGCTGG
TGGATGCGCTGCTGTACTACCCACACAAGCTGATCCCGTCGGCGCTGTTCACGCCAATATTCGAAGCAGCCATCTCGGCG
TTGGCGCTGGAGCAGCGCGACCCGTTGTCGGCGACGCTGCACTACCTGCGCGACCTGTTGACGTACGGCGGGTCGAATCC
GGCGCAGTCGGGCGGGCTTCCGGCCGAGACGGCGGCCCAACTGCGGCTGATCGTGCAGCAGCTGCTGGCGGTGCGCGGCG
AGGTGCTAGTGAAGCAGGTGCTGGCCGGCATGATGATCACGTTCCCGCGCGACTGCTTTGCCGACGGCAGCGGCGTGCTT
CTGTCGATGTTTGAGCTGCTGCCGGCCGAGACGACGGCCTGGCTGGACCGCACGCTGCAGATGCTTCCGGCGGGCACAGT
GGCGCCAGACGAGGTGAGCCGGCTGATTGTCAAGATCCGCGACCGGCTGCAGAACCCCAGTCAGGGCGGGCTGCGCCAAG
TGCGCGCGCTGCTGCAAGACTTTACCAACTCCTATCGGCGGCGATACATTGCGCCGCGGGACGGTCTCGGCGAGTTGGAG
GCCACGCGCTTCCACTTTGCCGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62