GenePrediction:GLEAN_412 Details

Name: GLEAN_412
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1622039..1627828 (+ strand)
Length: 5790
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1622039..1622489 (+ strand)
Length: 451
Type: CDS
Source: GLEAN
Position: GCSC_167:1624225..1625167 (+ strand)
Length: 943
Type: CDS
Source: GLEAN
Position: GCSC_167:1626272..1626392 (+ strand)
Length: 121
Type: CDS
Source: GLEAN
Position: GCSC_167:1626460..1626851 (+ strand)
Length: 392
Type: CDS
Source: GLEAN
Position: GCSC_167:1627216..1627828 (+ strand)
Length: 613
>GLEAN_412 class=GenePrediction position=GCSC_167:1622039..1627828 (+ strand)
ATGCCTCCGCGTCGATTTGTTGGCCACCGCCCCTCAAAGGCTCCGTTTGCATTTCGACAGAGACGTCCAGGGACCAGCAG
GACGCCAGACATACCGGAAGTTATCCAGACGGTGCCCTCATCTCCTTCAGGCCTGTCGCCCGCGCTATCTCACGGTGTTG
GGACTGAATTCTCGGACGATGTCTTCGACATAGAGGACGACACTGTGGAAGTAAACGACGTCGTGATGGCGCTCGAGATG
AGAAACAATGGCGCAGTTGGCTGTGCATTCTATGTTGCCGCCAATGAGACTCTGTATCTTCAGGAAGATACACGTATCAC
AGGTCTTGAGCTTGTAGAGTCCCTTCTCCTCCAAGCACAACCTGCATCGGTTATCATTCCGAGTCGTTCGCCAGAATCTG
TTGTTGACTACCTTGAGCGACAATCGAGCCGTGATGATGCAGGTGTACATGGTAAGTTGCTCTTTCTAAAAAAAAAACAG
GTGGTTTTCTTACCATTTGTTCAATGACATGCTTGCCACATCTAAATATAGCAGAAGACCGAGGAAATTCCTTTACCGTC
CGCACAGCTCTGTCCTGTACATTCAGTTCTGAATCTGGCAAAGAACGCCTTGCAAAGCTCGGGAGCCTGCAAACTCATGA
GCCATATGCTGCACAATTCGTAACTGCCACAGAGGATGGCTTCCACAGAAGTTGGGACGACGGAGAGGGCGAAGGACACC
AGCACAAGAGACATAGACGCAACGGACTCATGCGCCTTGGTACTTCTATCAGTCTTGACAGTGCTATCACTGTAGGCCTA
TGCTAGCCGACCCTGCCATACTCGAAAAAGTGCTTGTTCACAAACAGTTCTCGCTAACTAAAGCGACTTGCAGCTTGGCT
GTGTAAATGCTCTATTGTGTCTCTTGGAGCAAAGCCAGGAGGAAGCCAGCCCCGACAGCTCTCCTCCTACAAGAATCAGG
ACTGTCCAGATGATATCATACAAAAATTGCATGTTTGTCACTGCAGACACCATGTTAGCGTTACAAATATTTCGCCTGGA
TGGCCGAAGTAAAATCCAACGGCCCGTGTCGGATCGAAGGGCTAACGGGGAACACGGAAAGCAGCGAGCAGTTTTCGATA
TATTTCGTGCTTCCGTTATAACCCCACAAGGACACGCCAGGCTGCGGGAAGTGTTTCTTCGGCCTAGCACCGACCTGGCG
ATCATCGACAGGCGCCACGAAGCCATCTCAGTCCTTCTTCATGCTGACAACACGGGCACTGTGAGCTCTATTCGCGCAGC
TTTGAGAAAAATCAAAAACATACACTCGCCGTTTCAACATCTAAGAAAGGGTGTTCTTCTTCCAGGCAGCCGTGTCTCGA
TGAAGCAATGTGCCTGGACAAGTCTAGGGGCTTTTTGCAAGCATTCGGCAATTCTAGCCCGTCTCGTACAGCAACTGCCA
CATACAGGCTCTAACTTTGTTGCAGAGGTATGCTAGTCCAACTCATACGGCTTATACAAGATCCAATACACGATCTGTAA
GATATATGTGGCTGACAGTGTCTTAATCAGATCTTCTCAGACGTCTCAAGAGAAGAAATTTCTAAATTGGGTGCGAGGGT
TGACCGAACGATTGATTTCGAGAAATCCAAGTCGACCGGCTGCACCGTAGTAGCCGAAGGAGTTTCACGGGAGCTTGACG
GTTTCAGAAAAAACCACGACAGTCTCCATAACCGCCTCGACAGTATATGTGACGGGTACCGTTCTCTGCTTCCTCTCGGA
CTGCCCGATGTGATTATTGGATGCATCTTCCACCCACACATGGGGTATCTCGCAGTTACTACCTTGGATCCCAGAACCCT
GGAGGAGACTAGAATAGGGCAAGCTCACAGTCGCAGGGGTGGCTTTGACACCTGGGAGGAAGCCCTGCAAGAAGATGGAT
TGGTCTATTTCAAAACACCGGAGATGGATGGGCTAGACAGCCAATTCGGAGATTTGGCAGGTCGAGTAATCGGTAAGTAC
TGTCTGCCGTGCTCCTATTCGATAGTTTTGCCCCTTTCGCATCCTCGTATATGTTCATTGATAATGCAGAGTTTGAGGCG
AATATTCTCCACAGTCTCAGGCTCGAGTTTCTATCAAATGAGACGGTGATATTTCGGGCCTCAGAAGCAATTGGAGAGCT
TGATTGCCTCATGGCTCTGACAGCAGGAGCTGAGAGTTTCGGCCTCTCTCGTCCACAGATGTCGGCCGAAAACGTGCTAG
AAATTCAAGGAGGCCGACACATGCTTCAGGAGCTCGGCCTCGGAAAATTTGTTCCTAATGACTGCCGACTTGTGGGAGGG
CTAGGGTCGGAAGACGACAGGGATGCCGATGAAAATGAGCTGTTCAGTCGACAGCCTCCGATGCAAGATGCACCAAGTGC
CATAATTTTAACGGGCCCCAACCATTCGGGCAAGAGCGTCTATATCAAACAGGTGGCCATCATCGTCTATCTGGCCCAGG
TGGGGAGCTTTGTGCCAGCCAATAGAGCGGTAGTTGGCATAACGGACAGAATGTTGAGCAGGATTGCAACGCGGGAAAGT
GTCTCGAGGGACGAAAGCGCCTTTGGCGTCGACCTCCGTCAGGCCGCCTTTTCCATCAACTTTTCAACACGGCGTAGTCT
GATCCTAGTTGACGAGTTCGGAAAAGGGACAAACGAGGTTGACGGGGCTGCTCTCTTTCATGCCCTGATGGACCATTTTC
TGGGGCTGGGTCGCAGGAGTACGCCGAAAGTGTTGGCTGCAACACACTTCCATGAAATATTTGACAGCGGTTCTCTGCAG
CAGCACCCAGGACTGAGGCTGGCGCACATGAGCGTCAGTATCGACACGGGTGCATCACAGGCAGAAGACAAGGTCAAATT
CCTCTACAAGCTTCAGCCGGGTCACAGCTCCGACAGTTTCGGCTGTCACTGCGCGGCCATAAATGGCGTTGATGCTGCTG
TTGTCGACAGGGCCAGGCGGATTGCCGAGTCGCTAGCACACGGCGGGCGGCTCGAAAAGATGTGTCTGGAGCTGCCTGCC
GCGGAAATTGGGAGGCTTCAGGACGACGAGAACCGGGCACGAGTGTTTCTTTCAGAGATGGAGCACGAGGACTTAGTACG
GCAGAAGTGGTCCAGCCCCCAAGATCTTCTGAGGCGTGTCTTAGACGATCAGGCTGGTTGAGTACATTTGAGTGCAAGTA
CAGACGTTTTCGACAAAGAGTGGTGGGCGGTCGATGAGAGATGCATGGCCGAACAGCCGAGGTACAACCTCATAGGATCT
GTCCAGCTTGAAGAAGAGTATCATGTATTTTTGGGAGTGCGTCACGTCTGAAACGAGAAAGCGTTGCGTTTTAAGCAGAC
TCTTTTCACATGTATATTACGCGTGCACTCCTGAGAAGGCTGGTGTGAAACGGACCTACTGGTAATCCATACCGTAACTG
TTTGATGCTTATAGGGAGACTTATAGGTGGTTTTTAGTTGTATACGGAGTGCCAGGCCAAGTTATTGCTCAGCGGTAAGA
TGGCTCTCCATTGTGGACGGACCCCCCAGGAACAGGCATGAAATGCAACGCAAAAGCCAGTTATTGAAGAGGAGGCATTG
ATAGGACAGCAAGTGGAGGTCGGTCTTAATCGGCGTAATATGAATTTACAAGCATTGACAATTCGGATATACGATTGCTA
TGGCATGGACTAAAAAGAGGCGGAGGAAGGAGCAGAACGGTGCATGATTGATGAGATGCTGGCCTCTCATTGGTGCGATT
GTGTATAGTTCCTGGGGCAGCTACATAATAGGCTCCGAACGGCAGTAAGATGCATAGTAGTGTTGGCGATGGATACTGGC
TTGCAAAAGGTGCCTGCGGCGAGTGCCCGACAGTGGTGCGACAGATGGCCGGGAACAAGCTTCTTGGGGGTGGATTTCAG
CGTGGGCTTGGGCGACGGCAACCAGGGGTCTCCTTGAAACAGGGTCGAGGTCTGGCGTTTTGTTTCTTCTCCGTCAGGCG
GGCACATCTGCAACAAGCAGGGCTGGAACGAGTGCGATGGGGCATATTCTTGGAACTGAGACGTCTGTTCTGCGCACGGC
AATAGAATTGGACGCGTGGACAGGTTGTCGGCCAAACAGCCCATTAAGCTATAAATCACAAGGCTCTCGTCGTCTTATTT
ACAGTATTCGATATCATATTATTCCAATACCAATCTGCAACACCATCTTACAATCAGATCTCTAAATCATCAGCCTATCA
CACAATCACTACACCCAACACGACATCACAAACACTCACCACCACCACACCACATTCAAAATAAAGTTCACTGCTGTTCT
CATCTCTGCTCTGGCTGCCGTTGCGGTCGCTCAGGTGAGAAGTCTTCGCCGGGCGCTGCCCACACTGCTTCATCGGGGAC
AAGCAAGCTAACGAGAGGCAGGACTCCTCATCCACTGAAGTGGCCACCACCAAGACCAAGAAGTCCAAGAACACGGACAC
GGCAACTGACGCGACCGTTGCGACGGCAGCGACGGCAGCGACGGCAGCGACTGATGCCTCTACCACGTTGGTAGCCACCA
CCAGGACGAAGGGGTCAGGCAAGAACTCGACTGCCACGACGACCAAGTCAAAGGCAGAGGGCACAACTAAGGTCTCCGGG
GCGACGACGACCAAGTCGTCAGGGAAGAACTCGACCAAGACGGGCGAGAGCAGCTCTGCCACAGCCTCATCTACAGGCAC
TGTGACGGTCAGCGGTGGACAGACGCTGTTGGGTCCTGGCGCTGGCGCCATGATGACGATTGCCGGGCTGGCCCTGGCTT
TCACCCTGCTGCTGTAAGCTGGTACGGGGGATATGTGGGATATGGACATGGGACATCAATATCATTAGCATCTATGGAAG
ACCAAGATTTGTGGTTGGGCGTTTATTATCAGCAGCTACTACTAGCAATCGTTTATAGTGATTATTTATCTGCAGAGCAG
GGAATTTTCTGCCGCCGCAGCACTAGTGAGAATGACGTGCCTGGAACCCCGCCATTGGTCGAATTGAGTTTTGGGGCGAG
TTTTGTCTCTGCGCCGAAACCGCAGCCGGGTGAAATTTCTGCGACATCCATTGACAGACGACGCAATGGCAACGTGAGTG
TTTGCCAGCAGAGAGAGAGAGAGAAAGAGAAAGACAGGAATTCTGACGCTGTGACAGTAACATCACGTGGCATGCCGGGT
TGACGCGCAGCGAGCGCAACGCAGCGCGCGGCCAGAAGGGTTTTACGATCTGGTTCACGGGCCTGTCGGCGTCGGGCAAG
TCGACGGTGGCAACAGCGCTGGAGCAGCACCTGCTGCACCTGGGCCTGTCGGCATACCGGCTGGATGGCGACAACGTGCG
GTTCGGGCTCAACAAGGACCTCGGGTTCTCCGAGAAGGACCGCAACGAGAACATCCGCCGCATCGCCGAGGTGGCCAAGC
TGTTTGCCGACGCGTCCACGGTGGCCATCACGTCCTTTATCTCGCCGTACCGTGCCGACCGCGACGTGGCCCGCGCGCTG
CATGCGCAGACGGCCACCGCGGCTGACGAGCCGCTCGCTTTTGTTGAGGTCTACGTCGACATCCCGCTCGCTGTGGCCGA
GCAGCGCGATCCCAAGGGCCTCTACAAGAAGGCCCGGGCCGGCGAGATCAAGGAGTTCACCGGCATCTCGGCACCCTACG
AGGCACCCCTGCAGCCCGAGGTGACGATCCGGACGCACGAGCAGACGGTCGAGGAGTCTGTCGCCCAGATCGTCGCCTAC
CTGCAGGACAAGGGCCTCATCACAGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62