GenePrediction:GLEAN_4130 Details

Name: GLEAN_4130
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2962665..2964609 (+ strand)
Length: 1945
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2962665..2962682 (+ strand)
Length: 18
Type: CDS
Source: GLEAN
Position: GCSC_113:2962782..2963571 (+ strand)
Length: 790
Type: CDS
Source: GLEAN
Position: GCSC_113:2963642..2964609 (+ strand)
Length: 968
>GLEAN_4130 class=GenePrediction position=GCSC_113:2962665..2964609 (+ strand)
ATGGCCTCGAGCCTCAATGTAAGTTCCGATAATCTGAGTCTCACGAGCTATATTTGCCAGAACCCAGGCCGGCATTCTCT
CCTCTCCCATAGCTCACAACCCTTTTCACTGTTGCAGGACCCAAAGCTGCTGTACGCCATAACTGGCGTCTCGGCCTACC
ACATCGCCAATGGCGTCGAGGACTCGCTGACGCCTGCTGGGCCACAAACTCTGTCTCTCCTCATGGTACCTACCGCATCG
CCCTTTGCCGACCTCTCCATCGACTCTGCGGCCGGCAGCAATCCACAGGAAGAGGACTTCTACCTCCACCTCCATTTGCC
ACCTGAGCTCGATCTCCCGCTGCCGGCCACTACTCAGATCTACCACCAGCCACCTTCCAGCTATTTGATCCCGCGTTGGG
ATCTTGGCCGCAACAGTGGCGTCTTCACGCGCATAGAATTCCCTCTGGCTGGCAGCCGCAAAGGCTTGCAGGAAGATGTG
GACACCTTCGAGACTATCCTGGCCCAGTGCACTGCCTTCCTCGAACGCGCACCGCCGCCCAAGACCAAGAATGATAGACC
TTACCGGCCGGTGCCGGCGCCTCCGCCGTCTGCGGCTGCTCTTGTGAGAGCCAGCACTACCGGTGGTGTTGGGTCTTCCA
GCCGCACATCCACCGGCCATTACCAGTCGGACCAGAAGCCTCGCCAATCTCTATCCCGGTCCTCCACCAGGTCTACGATG
GCAGAGGACCTACCGGCATATAACCCAGCGACTTTCAAGCCGGGCGAGGCCTATGCGGCCGGCAGCCATAGCTCCTTTGT
TGGAGGGCAGATTGTGCTGATCGACGAAGAGGACGGCAGCGTCATCGGCGAGCTTGGCGAGGGCTTTCAGGTGATAGAAG
ACAAAGCACTGACACCTGGCTCCAAAGGTTCGCCTCATCGACTGCTCCCACAGCTATTTTTGTCCGTCTTTGTCTGCACC
ATTTGCTAACAGCACAGAACCGGTGGAGATAACACTGCCAACTGATGCTGTCCCCAGCATCTCGGTGGCGCCAGCCTCTC
GTGAGGACGTGGAGGCGCTGCACCCGGCCTACAGGAAGTCACGATTGGTGTCCAATGCAGCAGCAGCATCACGACTCATC
GTAGCCACGTCCGAGGTTGTGTCCAAGGCACTGCAGGCCCAGGCCGACAATTATTCGCGCAAGAACGAGCCGGCCAACAA
GCCCATCACCTTCAAGGCGAGCACACACGAGCACGTCCGTCGCATCAACACGTTGTCGTCCGGCGCTGCCAGCCTCTCGG
CCAAGGCGGTCGGTCAGGTGGGGAAAGTGGCGCAGAACTTGGGCGCATCGCTGGCGGGACACAAAGCTGGCCGGGAGGGC
GAGGGCGGCAGCGCCAGGGGCGACGGTGCTGCCGGCCTCCGTGGCAGTGGTTCTGGCAAGGGCCGCGGGCCTTCGGCCAA
AGGCTACGGACCGGACGGCGAATACATTGACAACTTCAAGCCGGGCCTGCTAAACAAGAGCCTGATGGCCTTCTCGACCG
TCGCCGACGGCATTGAGCAAGCCGGAAGACAGCTGCTGGACTCATCGTCGGTGGCTGCGACAACGGTGGCTGCACACAAA
TGGGGCCCAGAGGCGGCCGAGGTGACCCGGCACCTAAGCACCGGTATCAAGAACGTCGGGCTGGTCTATATTGACGTGAC
AGGTGTTTCGCGTAGGGCCATCATCAAGAGTGTGGCCAAGGGCATGGTGGTGGGCCACGTGCCGGGCGGCGGAGACCTGA
TTGTCGGTGGCGGTTCCGAGAGAACCGGAGTGACGGTCGTTCCAGGGCCTTATGACAACACGGCCAAGAGTGGCCGCAGC
AGCAGTCGCAGCAGCAGCATCAGTGTCAGCGGCAGCACAAGAGAGTCTCGCGACAATCGGGCGACAAGCAAGTTTTCTGA
CAACAATCCATACCGGGGACGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62