GenePrediction:GLEAN_4132 Details

Name: GLEAN_4132
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2969239..2971575 (+ strand)
Length: 2337
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2969239..2969537 (+ strand)
Length: 299
Type: CDS
Source: GLEAN
Position: GCSC_113:2969794..2970040 (+ strand)
Length: 247
Type: CDS
Source: GLEAN
Position: GCSC_113:2970469..2971093 (+ strand)
Length: 625
Type: CDS
Source: GLEAN
Position: GCSC_113:2971160..2971575 (+ strand)
Length: 416
>GLEAN_4132 class=GenePrediction position=GCSC_113:2969239..2971575 (+ strand)
ATGTCCAACAGCCTCTCCTTTGGCAATGTCAATGGCCTGAGGCGCGGTTTCCAGCAGCACACCAACGCTCAGTCAAACAA
ACCGCCGCCGGCAACCCTCTCGCACGCCACGCCCTACCAGACCTTCCATCCGGCACAGCAGACGCCATCGCCATATCCCC
ATCACCTCTTTCCCGGCACCGCGCCACCTCCACTTCAGGCTGTCCCCGGACTCCAAAATGCCGGCCCTCGACCATCGCCG
CCGCAGGTCACGGCCACCGTGCCACGAACACGACAGATGCAGCCGGCTCAGCCCGTCGCGTACCTTGCGCAGGCGCTAAA
CCAGCAGACGATGGGACACCAGGTACAGCAGAACGACGGCACGCTGATGGCCCAGCAGCGACAGCAGCAGCCGCAACACC
CCCAGCATCCGCAACATCCTCAGCATCCCCAGCACCAGCAGATGACGCAGCATCAACAGCACCCACAACAGCTCCAGCAA
CATGCTCAGCACCCGCAGCAGCATCCGCAGCATGCCCAACATCCACAGCATCCACAGCATCTCCAACATCCGCAGCATAC
CCAGCATCCTCTTCCTCAACACACACCGCACCCTCAGCACTCACAGCATCCTCAGCATCCTCAGCATCCTCAGCATCCTC
AGCATCCTCAGCATCCTCAGCATCCTCAGCATCCCCAGCACGCTCAGCATCCTCAGCACTCCCAGCATCCTCAGCATGCG
CAGCACCCACAGCTTCCCCAGCATGCTCAACACACGCAACACCCGCTCCCGCAGATGCCTCAACATTCCCAGCCTCCGCC
AAGTACCATACAATCCCAGACACTTTCCCAATCTCCTATACCTCCATCGCAGCAGCTTCAGCAGGTCCAAAAGGCCCAAC
AGGCTCAGCAGCAGGCTCAGCAGCAAGCTCAGCAGCAGGCTCAGCAGCAAGCTCAGCAGCAGGCACAGCAACAGGCGCAG
CAACAGGCGCAGCAACAGGCTCAACAACAGGCTCAACAACAGGCACAGCAGCAACAGCAGCAGCAACAGGTGCCTCCCAT
ACAGCAACTGCAGCAGGTACAACAGCAGGTGCAGCAGGCCCAGCAGCAGGTGCAAGTACAACAAGCCCAGCACATGCACC
AGGCACAGCAGGCGCAGAAAACACAGAAGTCGCAGGCCCAGCAGCAGGCCCAGAAGTTACAGCACGGTCATCAGGTTCAA
CACCAGCAGGCCCAGCAGCAAGCCCAGCAGGCCCAGCTACAGGTACAGAAGGCCGTCCAGAGCCACCATCAAGTCCCTCA
AGCATCACCGACGCCACCACCTCCGAAGCTAGAGGGCCCGGCTCAGCCGCAGGAGGACCAGATCGAAGACGAAATGGAGG
TGGAAAGCCAATCCAACGAGACGGGAGACGGCCAGGACGACAAAAGCAGCGATGCCAACATGCCGTTCGTGCCCAGGCAG
CCAATGGGCGCTCTGATGTCTGCACCCCCAGAGGGCGGCAGCTTTCCCACTCTGGAAGCTGTTCACAAGTTCGTGTTATC
ATACTGCACTTCGGTGGGCTATGCGGTAGTGATTGGTCGATCCAAAAAGACCGTACCTGGATTGAAGAAGGTTTTGTTTG
TGTGTGATCGAGCAGGAAAGCCCCCGAGGCGAGTAAGTCCGGAACAACGCAAGCGAAAGACGTCGTCGCGCAAGTGTGAC
TGCCAGTTTGGGTTTTTTGCCATCGAGCAGCGGACACAGTGGACAGTACGCTACCGACCAGACTCACAGCACCTGCAGCA
TAACCATGGACCCAGCGAGAGCCCGGTGCTGCACCCTGCAGCGCGGAAGCTGGACAGCCGTATGGTGGCAGCCGTGAAGG
CGCTCAAGGACGACGGTGCGTGCCTGACCCCTCCGAACCAAGGACATGAGAAGAACATCAGCTGTTCTAACACGTTCACA
GGTGTCGGCGTGAGTCAAACGCTTGAGATCTTGCAGACGGAAAACCCACATGTCCCGCTGCTTCCACGTGACATATACAA
TGCTCGTGCAGCCATCACGCGGAACCCGCAAAAGGTTGCGTCTGGCATTGCTGAGAACCGGCCGGCGATCTACAGCAAGC
CGCAGCCGACGGCCGAGGAGCGTATCCGCGCCGACCTCCGTCGTGAGCTGGCTAGAGCCCGCGAGGATCTCAGCAAGATT
TCCGAGGAAAAGCAAAAGGAGATTGACGAGCTCAAGCAGAAGTTGCAAGAGAAGGACCGAGTGATCCAGCGGTTCGAAAT
GTTTATTGACATTTGCAACCAGAGGGTCATCCTGCAACGCGAGAGACTATCGGACTCCAACGAAGGAGGTAGCGAAACCG
CCAACACAGCATCCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62