GenePrediction:GLEAN_4133 Details

Name: GLEAN_4133
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2973014..2987486 (+ strand)
Length: 14473
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2973014..2986344 (+ strand)
Length: 13331
Type: CDS
Source: GLEAN
Position: GCSC_113:2986532..2986632 (+ strand)
Length: 101
Type: CDS
Source: GLEAN
Position: GCSC_113:2986717..2987486 (+ strand)
Length: 770
>GLEAN_4133 class=GenePrediction position=GCSC_113:2973014..2987486 (+ strand)
ATGGAGATTATTGCTCCATCTTCCGTGGCTGGCAGCTCCAGCCTCGGTGGGATCGGCTCTTCCGGGGGTGGCGTATCCCC
ATCCGCTACTGCTGGCACTGCGACAGCCCCCTCCTATGTCGATCCGACTCGCGTCATCGAACATCTTACGGCCGTTCTCG
AGGCCGCTCTTGGTGCCACCCGTGATGAGCTGGAGGCCCCGGGCAGTCTGCTGTCGAAATCGCGCTACGCTGATACCGTG
CAGCGGTGCTCCCGCTTCGCCCATGAACCCCAGGTTGTCTCGCTCTATATCCAGAAAGATGTGCTTCCAGCTCGCATAGA
CGAGGACAAGGGGACGCCGTCCCCCCCCCAACACCTGTTCACCCTTGCGCCTGATCTCTCTGCCGAAACGACTACAGTGG
CTTTTCTCGTCCTTCTCAAACGGCCGCAGCCGTTGGATCCGAACGTGCCCATCACCTCCCAGGTCCAGATGCTCAACCTT
CCCGGTCCTGCATACTTGACGGCGACGGCTGGCGAGCAGGGCCTCTCGACATCGCCTTTTGAGATTTTGCAGCTCTACCT
GCACAACGGCCTCGCGCCCTACTTTGATGCGAGCACGAAGCCAGCTGCTGGTGCGGCGGCGAACGGCACTAGCCGTGGAC
GTGCTGACCTCGAAGCCAAGACAGGTGTGCCCGTGACGAAGAAGCGATGGACGGAGCTGGAGCTCAGTCTGGCACACCTG
CAGCAGAACGTAGAGATCCCCGAGGTCGTGCTGCCCTTCCCACCCATTGTGCAGAATGCTCTCGACGACGCCAGCGGCAA
CAGCACGCGGCCATCCTTCGACCAGCTCCCGCCAGGCGTCACGCAGGACACTGCCCTCCTCAACAGCCTGCAGGCTACGG
TCAACACGTGGATCAAGTCCATCCAGGTCGTCACCAAGATGACGCAGGACCCCACCACAGGCACGGCCAACCAGGAGATC
AACTACTGGCTGTCCATGGAGTCTGCCCTGGAGCGCATAGAGGCTCAGCTGCGTGGCGATGGTGTGTCGCTGACACTGGA
CATCCTCAAGCATGCCAAGCGCTTCCAGGCCACCGTCAGTTTTGTTGCCGACACGGGCCTGAAGGAGGCCATGGAGCGTG
TGCAGAAATACAACCAGTTGATGCGGGACTTCCCTCTGGACGAGCTACTCTCAGCAACGGCACTGGCCAAGGTGGAGGAC
TCGATTGTGCAAATCTTTAGCCACCTCAACAAGAAGCTGCGCATCTGCCCGTATCCGATTCGGCGCGCCCTTGCTCTGGT
CGAGTCGATCTCAAGCGACCTAGACGACACGATGCACCGCCTGTTGTCGGGCACCGAGCTGGTGGACCTCGACTATGCCG
AGTTCAATCGGGTGATGAGTGCGACGAACGACATCTTTCGTGCCTGGGACGACAATGTGAAGGAGTTTACCAACGTGGCT
CGTGAGGTCACGCGTCGCCGCAACGACAAGTTCATCCCTATCAAGATCAACCCGCGCCATGCGCAGTTGCAGGCGCGACT
GAAGTATATTCAGACGTTCCGCGAGAACCATGAGCAGCTCCAGCGGACCATTGTTACGGTGCTCGGCCCCACGGCCGCCA
ACGCTGCCGCTGGCGACGGCGCCGATGGCAGTGCCAAGGCTGCGAACGGAACCAACGGCCCCAGCGGCGTCAACAGCGGC
AACGGCGGTGCCTTTGATGAGACAGGCGACATGGATGCGGTGGAGGAGGTGCGGCAGGCCTGGGAGGCCCTGCGCAATGT
CGACCTGCTGGACGTGACGCCCGAGGGGACGGCCAAGTGGGCACGCGCGGAAAACGCGTACAACGAGCGAACGGCGCGCG
TGGAAAACTCGATCATCGCCCGGCTGAGGGACCGTCTGGCCACGGCCAAGAACGCCAACGAGATGTTCCGCGTCTTCTCC
AAGTTCAATGCACTCTTCGTGCGGCCCAAGATCCGGGGTGCCATCGCGGAGTACCAGACGCAGCTCATCGATAATGTTAA
GCAAGCCATTGCGGCGCTTCACGAGCGCTTCAAGCAGCAGTACGGCCACTCGGAGGCCCATGCCATGGCCACACTGCACG
ACCTGCCTCCGGTGTCTGGAGCGATTATCTGGGCGCGGCAGATCGAGCGACAGCTAGACAACTACATGAAGAAGGTGGAG
GACGTGCTGGGTGCGGACTGGGCACTGCACGCCGAGGGCCAGAAGCTGCAGAACGAGAGCGTGCAGTTCCGGAACAAGCT
CAAGACGGTGCCGATTTTCGAGGCGTGGGCCCGCGACACGATGCGGCGCGAGGTGTCGATTGCCGGGCGGCTGTTCAGCA
TCAAGCGAGTGCGTGCGGCGGGCAACAAGCTGGAGCTGGGCGTCAACTTCGATCCGCAGGTGATTGCGCTGTTCAAGGAG
ACGCGCAACCTCATCTGGCTCAACTACTCGGTGCCGCACGCGGTGACGACGGTGGCCAAGGACGCCAAACGTGTGTATCC
ATACGCAGTCAGCCTGATGGAGAGCGTGCGGACGTTTGCGCAGACGCTCCGGGCGATTAACGAGATGCCGGAGGTGTCGA
TGCTGCTCAACGGACACCGCAACGACGTGTATTCGCTGGTGGCAAAGGGCGTGCCGCTGCGGTGGGAGTCATTTGTGAAC
AGCTACGAGGTGCATCTGCGCGGACTGCCACACATGCCGAACGGAAACGCGATGGACCGGCTCAAGGGCGGCGAGAGTCG
GCACGTGCTGTTTGTGCGAGAGATTGCGGCGGCAGTATCGCTGCTACAGACCAAGACGGCCACGCTGGCGACGTACCACG
CGACGATCCAGAAGTCACTCAAGGAGCTGGCCACGTGCCCGTACAATGCCAACGCGTTCGAGACGCGGCTGCGGGCGATC
CAGGAGGCGGTAGACCAGCTCAACCTGCAGCAGTATGCCAACCTGGGCTTCTGGGTGGAGGGCATGAACCGACAGATCAA
GGCGACGCTGCTCACGCGGCTGCAGCGGGCAATCCTGGCGTGGATCGAAGCGTTTGAGAACGATGAGGCGGCCGAGCCGA
ACAAGACCAAGTTTGCGTTCGGGATGGGCTTCGGCGGCGGCTCTGGCGGCGACGAGGAGCGTCGGCGGCCGGTGACAGCA
GCAGCAGCAGGAACGGCGGACGCGACGGTCAATGACGTGCCGACGATGAAGCATCTCGTGCACGAGGTGACGATGCGCAA
CCAGCTGATCTATCTGGACCCACCGCTGGAGTTTGCCCGTGCGAGCTGGTACCTGCGGCTGCACGAATGGCTGGGAGTGA
CGTGCAATCTGCGCAAGATCAAGGCAACGAGCTACGAGATGCGACTGGGCACGACGGTGGTGGAAGACGCGCGGTTCAAC
GACCTGCCGGCGGAGTGCACGACGGTGCTGCTGCGGGTGCAGACGTCGATCGAGACGAAGCTGGGAGCGATCGGGTCGTA
CGTGGACGAATGGCTGCGGTTCCAGTCGCTGTGGGACCTGCAGTCAGAGAAGGTGTACGACCTGCTGGGCGACCAGCTGT
CGCGGTGGCTGCAGCTGCTGCAGGAGATCCGCAAGACGCGGCAGACGTTTGACACGACCGAGGTCAGCCGGTCGTTTGGA
CACATCACGATCGACTACGACCAGGTGCAGACCAAGGTCAACGCCAAGTACGACCAGTGGCAGCACGACATCCTGCTGAA
GTTTGCGGGCCGGCTGGGCGGACGGATGCGCGAGGTGTATGCCGAGATCGAGAAGGCGCGGACGGACCTGGAGACGCTGA
GCCTGGAAGTCAACTCGACGGCGCACGCGGTGCAGTTCATCACGATTGTGCAGGCGTGCAAGCGACACGTCAAGGTGTGG
GCGCCGGAGATCGAGACATTCCGGCAGGGCGAGTCGACGCTGGTGCGACAGCGATACCAGTTCCCGAACGACTGGCTGCA
CGCGCAGCAGGTGGACCACGAGTGGAACTCGCTGAACGAACTGCTGAGCCGCAAGGCCAAGATCGTGCAGGACCAGACGG
ACGCGCTGCGGGCCAAGATCATTGCGGAGGACGCGATCGTGGCGGACAAGATTGCAGAGATTGCAGTGCAGTGGAACGAA
GAGAAGCCGGTGTCGGGGACCATCGCGCCGGAAGTGGCGACGGCGACGCTGGCGGCGTTCGAGGGCCGGATCACGACGCT
GCAGGGCGAGGCAGCGATGGTGGCCAAGGCAAAGGAAGCGCTGGACCTGGCAGCAGCAGCGGAGACATCGCTCAACGGGA
TCCTGGAGGAGGTGCAGGACTTCAAGTCGGTGTGGGCGTCGCTGTCGCTGATCTGGAAGAACCTGAGCGAGCAACGGGAG
ATGCTGTGGAACAGCGTGCAGCCACGCAAGGTGCGGGCATCGATCGACAACCTGATCAAGATGACACGCGACATGCCGAG
CCGAATGCGACAGTATGCGGCCTTTGAACACATTCAGGAGCGGCTGCGGACGTACGTGCGGGTGAACCCACTGCTGGGCG
ACCTCAAGTCGGAGGCGGTGCGCGACCGGCACTGGACCAAGATCTACAAGCAGATCCGGCCGGGCAAACGGTACTCGCCG
GTGTCGATGACGCTGGGCGACGTGTGGGACCTCAACCTGGTGGCGACAGAGGCGATCATCCGCGACATTGTGGCGCAAGC
ACAGGGCGAGATGGCGCTGGAGGAGTTCCTCAAGCAGGTGCGGGAGACGTGGACGAGCTATAGCCTGGAGCTGGTCAACT
ACCAGAACAAGTGCCGGCTGATCCGCGGATGGGACGAGCTGTTTGCCAAGTGCAGCGAGAACCTCAACTCGCTGCAGGCG
ATGCGGCACTCGCCGTACTACAAGGAGTTTGAGGAGGAGGCGTCAGGGTGGGAAGACAAGCTGAACCGGGTGCACATCCT
GTTCGACGTGTGGATCGATGTGCAGCGACAGTGGGTGTATCTGGAGGGCGTGTTCACGGGCAACGCGGACATCAAGCACC
TGTTGCCGATCGAGTCGTCGCGGTTCCAGAACATCAACAGCGAGTTCTCGGCCGTGATGAAGAAGATGTACAAGCAGCCG
TACGTGCTGGACGTGCTGAACATCCCGAACGTGCAGAAGTCGCTGGAGCGGCTGGCAGAGCTGCTGAACAAGATCCAGAA
GGCACTGGGCGAGTACCTGGAGAAGGAGCGGGTGTCGTTCCCACGGTTCTACTTTGTGGGCGACGAGGACCTGCTGGAGA
TGATTGGCAACAGCAACGACACGGTACGGGTGGCGAAACACTTCAAGAAGATGTTTGCCGGGCTGTCCGGGCTGGTGATG
GGCGAGGACGAGGCAGAGGCGGTCATCACGGCCTTCTCGTCGAAGGAGGGCGAGGTGGTGCGGCTGAAGCGGTCGATCTC
GCTGATCAAGACGCCGCGGATCAACGACTGGCTGGCGTTGCTAGAGGGCGGCATGAAGCAGACGCTGGCCGAGCTGCTAG
GCGAGGCGATAGCAGCCTACGGGCCAGTGTTTGCGGCCGAGACGGTGGACCCGACAGCGATGGAAGCCTTTCTGGAGGGC
TTCCCGAGCCAGATTGTCGTGCTGGCGACACAGGCAGTGTGGACGACGGCGGTGGACGCAGCGCTGGCAGACGAGAAGCA
GGCGGGCGCAGCACTGCAGCGGCTGTTTGAACGTGAGGTGCAGGTGCTACGGCTGCTGGCGGCGATGGTGCTGGGCGACT
TGGACGTGTTGGTGCGGCGGAAATGCGAACAGCTGATCACGGAGTGCGTGCACCAGCGCGACATTATCGAGAAGCTGGTG
GCAGCCGGAGCCGACTCGCCGACACACCATCTCTGGCTGCTGCAGATGCGCTACGTCTATACCAGCAGCAGCGAGACAGA
GGCACAGCAGCGGCTGAGCGTGCGGATGGCCAATGCGACGCTGCAGTACGGATTCGAGTACCTGGGAGTGCCGGATCGGC
TGGTGCGCACGCCGCTGACAGACCGCTGCTTCCTGACACTGACACAGGCGCTGTGCCAGCAGCTGGGCGGCTCGCCATAC
GGGCCAGCCGGCACGGGCAAGACAGAGTCGGTCAAGGCGCTGGGCGTGGAGCTGGGACGGTTTACGCTGGTGTTCTGCTG
CGACGACACGTTTGACTTCCAGGCGATGGGCCGGATCTTCCTGGGCATCTGCCAGGTGGGCGCATGGGGCTGCTTTGACG
AGTTCAACCGACTGGAAGAACGGATCCTGTCGGCGGTGTCGCAGCAGATCCAGAACATCCAGCTGGGACTGCGACAGGGG
GCCGAGGACGACAAGGCGCAGATCGAGCTGGTGGGCCGACAGCTGAGGGTCAACGGCAATACAGGCATCTTCATCACGAT
GAACCCAGGCTATGCGGGACGGTCGAACCTGCCGGACAACCTGAAGAAGCTGTTCCGCAGCGTGGCCATGTCGAAGCCAG
ACAAGGAGCTGATCGCGGAGGTGATGCTGTACTCGCAGGGCTTCGGACAGGCCAAGGCGCTGTCGAAGCAGACGGTGCCC
TTCTTCGACCAGTGTGCGGCCGAACTATCGCGACAGGCGCACTACGATTTTGGGCTGCGGGCGCTGAAGAGCGTCTTAGT
CAGCTCAGGTGGCCTGAAGCGGGCACGGCTGACGGACGGCCGGGCGACAACAGAAGCGGCGAGCCTGGGCGAGGTAGAGG
CGGTCGAGCCAGAGATTATCGTGCAGAGCATCCGCGAGACGATCGCGCCAAAGCTGATCAAGGCAGACGTGGCGATCATG
GGCGGGATCGAGGCGCGCTGTTTCCCGGGCGTGCGCTATGTGCCAGCCAACCTGGAGGCGCTCGAGACAGCAGTGCGGCG
GCTGGCAGGCGAACGACAGCTGGTGGTCAACGAGACCTGGCTGACCAAGGTACTGCAGCTGTACCAGATCCAGCGCATGC
ACCACGGTGTGATGATGGTGGGCAGTGCAGGCTCGGGCAAGTCGACCGCCTGGAGGCTGCTGCTGGAAGCATTGCAGCAG
GTGGAGAAGGTAGAAGGGGTGTGTCACGTGATCGACTCCAAAGTGATGTCCAAGGAAGCGCTGTACGGCAACCTGGATGC
GACGACGCGCGAGTGGACGGACGGGCTGTTCACGAGCATCCTGCGCAAGATCGTCGACAACCTGCGCGGCGAGGACGGCA
AGCGTCACTGGATCGTGTTTGACGGCGATGTGGACCCGGAATGGGTAGAGAACCTGAACAGTGTGCTGGACGACAACAAG
CTGCTGACGCTGCCGAACGGCGAGCGGCTGAACCTGCCGGCGAACGTGCGGATCATGTTTGAGGTGGCAGACCTGCGCTA
CGCGACGCTGGCGACGGTGTCCCGCTGCGGCATGGTCTGGTTCAGCGAGGACACGGTGACGCCGGCGATGGTGGTGGACA
ATTATCTCGGCCGGCTGGCAGCGGTGGCGTTTGAGGACCTGGACGAGGACGCGGTGGCGACAGGCCAGAGCGCAGCGCGA
GCGCTGGCCGTGCAGACACAGGCGGCCGAGCTGCTGCGGTCACACCTGACGACAGACGACTTTGTGCTCGAGGCACTGAA
CCGGGCGACGACATACCGGCACATTATGGACTTCACGGCAGCACGGGCACTCAACACGCTCTTCTCGCTCGTCAACAAGG
CGGTGCGCAACGTGATCGAGTACAATGCACAGCACGCAGACTTTGCGCTAGAGCCAGAGCAGGTGGAAGCATACCTGTCG
AAGAAACTGCTGCTGGCGATGGTATGGGCGCTGACGGGCGACTGTCCGCTGGAGGACCGGCAGGCGTTTGGCGACGTGCT
AGTAGGCCTGGCAGGCTTCGGGGTGGCGCCACCAGCAGCGGGCGGATCGGTGATCGACTTTGACGTGTCGCTGCCGCGGG
CAGAATGGACTTCGTGGCAGGCACAGGTGCCGTCGGTCGAGGTCAACACGCACTCGGTAACGCAGACAGACGTGGTGATC
CCGACGCTGGACACGGTGCGCCACGAGGATGTGCTGTACTCGTGGCTGGCCGAGCACAAGCCGCTGCTGCTGTGCGGACC
GCCGGGATCGGGCAAGACGATGACGCTGTTCAGCGCGCTGCGCAAGCTGCCGAACATGGAGGTGGTCGGACTCAACTTCT
CGAGCGCGACGACGCCAGACCTGCTGATCAAGAGCTTCGAGCAGTACTGCGAGTACAAGAAGACGCTGAGCGGCGTGCTG
CTGTCGCCGACGCAGATCGGCCGCTGGCTGGTGGTATTCTGCGACGAGATCAACCTGCCGGCACCAGACCGCTACGGGAC
ACAGCGGGCGATTGCGTTTCTGCGGCAGCTGGTCGAGCACAACGGCTTCTGGCGCGCATCGGACAAGGCGTGGGTGACGT
TGGACCGGATCCAGTTTGTGGGCGCATGCAACCCGCCGACCGACGCAGGCCGGACGCCGCTGGGAGCACGGTTCCTGCGC
CACGCGCCGCTGATGATGGTGGACTACCCGGGCGAGCAGTCGCTGCAGCAGATCTACGGCACGTTCAACGCGGCGGTGCT
GAAGATCATCCCGACGCTGCGCGGATACGCCGAGGCGCTGACGCAGGCGATGGTGCGGCTGTACACGGAGTCGCAGCAGC
GGTTCACGGCAGCGCAGCAGGCACACTACGTCTACAGTCCGCGCGAGCTGACACGGTGGGTGCGCGGCGTGTACGAGGCG
ATCCGGCCGCTGGAGGCGCTGTCGGTCGAGGGGCTGGTGCGGATCTGGGCGCACGAAGCACTGCGGCTCTTCCAGGACCG
GCTGGTGGAGGCGAGCGAGCGCGAATGGACGGAGGCGGCCGTGCGGCGGATCGCGCTGGAGCTGTTCCCCAACGTGGACG
AGGCCCAGGCGCTGGGCGGCCCGATCCTGTTCTCGAACTGGCTGTCGAAGCACTACGTGCCGGTAGACCGGGAGCAGCTG
CGGGACTTTGTCAAGGCGCGGCTGCGCACGTTCTGCGAGGAGGAGGTGGACGTGCCGCTGATCCTGTTCAACGACGTGCT
GGAACACGTGCTGCGAATCGACCGGGTGTTCCGGCAGCCGCAGGGGCACCTGATCCTGATCGGGGTCAGCGGTAGCGGCA
AGACAACGCTGTCGCGGTTTGTGGCGTGGATGAACGGCCTCAAGGTCTTCCAGATCAAGGTGCACGGCAAGTACTCGGCG
GAGGACTTTGACGAAGACCTGCGCGAGGTGCTGCGACGCTGCGGGTGCAAGGGCGAGAAGATGTGTTTCATCATGGACGA
GGCGAACGTGCTGGATGCGGGCTTCCTGGAGCGGATGAACACGCTGCTGGCCAACGCGGAGGTGCCGGGGCTGTTTGAGG
GCGACGACCTGGCCGCGCTGATGACGGCGTGCAAGGAGGGGGCACAGCGCCAGGGTCTGCACCTGGACTCGCAGGAGGAG
CTGTACAAGTGGTTCACCGGCCAGATCGTCAAGAACCTGCACGTGGTGTTCACGATGAACCCGCCAGCCGGCGCGGGCGG
ACTGTCGTCGCGAGCGGCCACGAGCCCGGCACTGTTCAACCGCTGCGTGCTCAACTGGTTTGGCGACTGGTCGGACCAGG
CGCTCTTCCAGGTGGCACACGAGCTGACGGGAGCGGTAGACCTGGAGCGGGCGCAGTTTGTGGCGCCAGACACGATCCCG
GTGGCATACGCGGGCCTGACGTTGCCGGCATCGCATCGGGGCGCGGTGGTGAACGCGATGGTGTACGTGCACCACTCGCT
GCGACGAGTCAACGGGCGGCTGCAGCAGCAACAGGGCCGGACGACATTCCTGACGCCGCGACACTTTTTGGACTTTGTGG
CGCAGTATGTGCGGCTGTACGGCGAGAAGCGCGAGGACCTGGAAGAGCAGCAGAGACACCTGAACGTGGGACTGGAGAAG
CTGCGCGACACGGTGGACAAGGTGCGGGACCTGCGGGCGAGCCTGGCATCGAAGCAGGCACAGCTGGAACGCAAGGACGC
CGAGGCGAACGAGAAGCTGCAGCGAATGGTGGCAGACCAGCGAGAGGCAGAGCAGCGGAAGAGCACGTCGCTAGAGATCC
AGGCAGCGCTAGAAGTGCAAGACGCCGAGGTGGCAACACGACGACAGGCCGTGCTGGAGGACCTGGCACGTGCAGAGCCG
GCAGTCGAGGCAGCCAAGGCGAGCGTCAGCAACATCAAGCGGCAGCAGCTGACAGAAGTGCGGGCGATGGCATCACCACC
AGCAGGCGTCCGGCTGGCACTCGACTCGGTATGCACGCTGCTGGGACACCGAGCAGGCGACTGGAAGACGATCCAGTCGG
TGATCCGACGCGACGACTTTATCGCGAGCATCATCAACTTCAACAACGAGAAGATGATGACGAAGGCGCTACGCGTCAAG
ATGCGGAGCGAGTTTCTGTCGAACCCCGAGTTCACCTTTGACCGGGTCAACCGGGCGAGCAAAGCATGCGGACCGCTGGT
GCAATGGGTAGAGGCGCAAGTGAGCTACGGCGAGATCCTGGACCGCGTGGGACCGCTGCGCGAAGAGGTGGCCGCGCTGG
CCGAGCAGGCACTGCAGACACGAGCACAGGCGCGCGCGGTCGAGCAGACGATCGACGGGCTCGAAGCCAGCATCGCGACC
TACAAGACGGAATACGCAGCACTGATCAGCGAGACGCAGGCGATCAAGGCAGAGATGGCGCGCGTGCAGCACAAGGTGGA
CCGCAGCGTGCGGCTGCTGGACAGCCTGTCGTCGGAGCGGGTGCGATGGGAAGAGGGCAGCCGGTCGTTTGAGACGCAGA
TCGGAACGCTGGTGGGCGACGTGCTGGTAGCAGCAGCCTTTCTGGCCTACGGCGGGCTGTACGACCAGACATTCCGCCGC
GCGATGGTGGACGACTGGCTGCAGCACCTGCGGCTGTCGGGCATCGCGACGAAGCCACACAACCCGGTGACCGAGTACCT
CTCGACAGCAGACGAGCGGTTGGGCTGGCAGGCGAATGCGCTGCCGGCCGACGATCTGTGCACGGAGAACGCGATCATTC
TGCGGCGGTTCAACCGGTATCCGCTCATCATCGATCCGTCCGGACGGGCGACGGAGTTTCTGCAGCGCGAGTGTCGCGGG
CGACGGCTGACGGTGACGAGCTTCCTGGACGACGCGTTTGCCAAGCAGCTCGAGAGTGCGTTGCGGTTCGGCAACCCGAT
CCTGATCCAGGACGCGGAACATTTGGATCCCGTGCTTAATCACGTGCTCAACAAAGAATACCAGAAGACGGGCGGACGTG
TGCTCATCCAGCTAGGCCGGCAGCAGATTGACTTTTCCCCGGCTTTCCGGCTGTATCTGGCGACACGTGACCCTTCGGCA
ACGTTTGCGCCCGACATCTGCAGCCGGACGACACTGGTCAACTTCACGGTGACGCAGAGCAGCCTGCGGACACAGGCGCT
CAACGAGGTGCTGCGGGCCGAGCGGCCGGACGTGGACGAGCGACGGTCAAACCTGACCCGGCTGCAGGGCGAGTTCAAGG
TACACCTGCGACAGCTGGAGAAGCGGCTGCTACAGGCGCTCAACGAATCGCGCGGCAATATCCTGGACGACGATCACGTG
ATCGAGACGCTGGAGACGCTCAAGACCGAAGCCGCCGACATTAGCGACAAGATGCGCGGCACCGAGGGCGTCATGGCCGA
TGTCGACGCCGTCACCCGCCAGTATGCCGTCGTGGCACGTTCCTGCAGCGCCGTCTTTGCCGTGCTGGAGCAGCTGCACT
ATCTGCACCACTTTTACCAGTTCTCGCTAGACTATTTCCTGGACATTTTCCACGCGGTGTTGCAGCGGGCCAGTGCAGCC
GGCACGGTCGTGGCCACCGGTGCGTCCGACGACACGTACAACATCCGACGCGACGCCATCGTGCGCGACCTCTTCGTCAC
GACCTTCCAGCGGACCGCGCTCGGGCTGTTGCAGAAAGACCGCATCACGCTGGCGATGCTGCTGGTGCAGGCGTCGCCAT
ACGCCATGGACAAGAGCCTGATCGACGTGCTGCTGGACGACGACGGCGTGCCGGGTCGCGACGTGTCGGGCATGGACGGT
CGTGACGAAGCCATCGCCTTGGCTCGCCGGCTGCCAGCGCTGCAGCAACAGGTCGACGGGATCAGCGAGGCCGAGTGGGC
ACGATTCCTGGGCGAGGAGCTGGCCGAGAACTTTGTGCCGCCAATGGGAGGAGGGGAGTCGAACGAGGAGAGGCCGAACG
ACGAGAGGGCGAGCGACAGCGAGGAAACCAAGAAAAACGACGAAGCCCTTCGGTCTCTGCTCATGGTCAAGCTCTTCCGA
CTCGACCGGTTTGTGCCGGCAGCCGAGCGGTTTGCGGCGCTTATCTTCGGCACAGACGACTTGTTTGACATTGTCGAGGA
TCTCGGCGGCACGGTGGCCCAGGTGCCGGCAACACGACCGGTGGCGCTGGTATCGAGCCCAGGCTTCGACGCATCCTACA
AGGTAGACGGGCTGGCAGCCCGGACGGGAGCGCGCTGCAGCCACATCGCGATGGGGTCGGCCGAGGGACTCGCGAGCGCA
GACAAGGCAGTCAGCAGCGCAGCCCAGACAGGAGCTTGGGTGCTGGTCAAGAACGTCCACCTGGCGCCGACCTGGCTGCA
GTCGCTGGAGAAGCGGATGGAGACGCTGCACCCACACGGCGACTTCCGGCTATTCCTGTCGATGGAGTCGAGTCCGCGCA
TCCCGGTGAATCTGTTGCGCGCATCGCGTGTCCTATTGTACGAGCAGCCAGCAGGCGTGCGGGCCAACATGAAGGACTCG
CTGGCGTCGCTGGCGCCACGTTGTGTGCGCCCGCCGGCCGAGCGGACGCGGCTGTACCTGCTGCTGTCGTTCTTGCACGC
CGTCGTCCAAGAGCGCCTGCGCTATGCCCCGACGCTGGGCTGGAAGGGCTTCTGGGAGTTCAACGACAGCGACTACGAGT
GCTCGGCCTTTGTGGTCGACACCTGGCTAGCCGCAGCTGCTGGTCAGCGGTCCAACATTGCGCCGCAGAACATTCCCTGG
GCCATGATCCGTCAGCTCGTCACCGAGACGTACGGCGGCAAGATCGACAACGAGGACGACTTTGCACTGCTCCGCCAGCT
GGTCGACCGTGTTCTCAGCCCGGCCGCCTACGATATCGGGCATCGCCTGCTGCTCGGCGACCTGACCGCCGACGCTGCCG
ACACGGACGCGCTCGTCGTGCCGTCCGGCACCGCGCTCGCCGACTGCATGGCCTGGATCCAACGCCTGCCCGAACGCGAG
CCGCCCACGTACCTGGGGCTGCCGGCCAATGCGGAAAAGGTGCTGCTGGTAGGCCTGGGACGCAGCCTGGTACAGGACCT
GCGCAAGGTGACGAACCTGCTGGACGAGGGGGAGCAGCTGATAGAGGAGGAGTAGGGTGAAAGAGGGAGGGATTAGTAAG
ATCGTTCTAAGAGAGAGATGGATAAGAATCGTTATAAGAATATACTCCACGTAACGCCACACGTCACGCGCCACACTGCC
ACAAGCTTCAATGTCCTTCACCTCTCGCTCTCGGCCGCAGAGAGAGACTGCTTCTTGGTCCCAAAACAACATCACCAGAC
GAGCAGACGACAGCCACGATTCTCTGACAGCTGAGCGCATCGTCTTCCATGGCCAGCCCGGCCACGCTGGCGTCGCTGTC
CATCAGCCACGTCTACTATGTGCGTCTTTGTTCTTTCTTTTCACTCTCCTCTCTTTTTCTGTCCTCTCGGTTCCTCTCCC
CTCTTTTCCTCTCCTCTGACCAGTCCAGAACCCAGATGACCCGGTCTCGTACGTCTGCGCCTGGCTCGCCCTCGTGCCCC
AAGGCCTCTGCGTCGTCTACGCCACTCTGCTCTGGAGCACGCGCGAGGCCGAGGTGGCCCTGGCCTTTGCCGGCCAGCTC
GGCTGCGAGGCCGTCAATCTCGTGCTCAAGCGCCTGATCAAGGAAGAACGTCCGCGCCACCACCACACAGCCCTGGGCCT
GGGCATGGCCCTGCCCGATCCCGGTCTCGGCAACGGACCCGACGCCGACCAGCTGCACCATCTGCCCTTCCGCCGCGGCT
ACGGCATGCCGAGCTCCCACGCTCAGTTCGCCGGCTACTGGGCCGTCACCATCGCCCTCTTCCTGCTGGTGCGATACCGC
GGACAGAATCGGATTCCACAGAACAGACAGAGACAGGAATCACCCCAAAACTCCTGGTCCCTAGCCGAACGCGTCGCCAC
CAGCACCGCCGCTTTTGTCGTCGCCGTGCTCGTCGCCTGGAGCCGCGTCTACCTTCACTACCACACCCCCAGACAAGTCC
TCGTCGGTTTCGCTGCTGGTCTCCTCGTCGGCTTCGCCTGGTTCGCTGCCACCACTTTCGTCCGTCGCTGCGGCCTCCTC
CGATGGGTTCTCGCCCTACCGCCCGCTCGCTGGCTCCGCATCCGAGACCTCGCCGCCGAAGAAGACGCCCCCCAGGCTGG
CTGGGAAAAATGGTTGCTCCTTCAAGCCGCCCGCGAAACACAGCTAGCTCAGGCTGCCGCCAAAAAGACCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62