GenePrediction:GLEAN_4134 Details

Name: GLEAN_4134
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2996665..2998424 (+ strand)
Length: 1760
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2996665..2997028 (+ strand)
Length: 364
Type: CDS
Source: GLEAN
Position: GCSC_113:2997359..2998322 (+ strand)
Length: 964
Type: CDS
Source: GLEAN
Position: GCSC_113:2998391..2998424 (+ strand)
Length: 34
>GLEAN_4134 class=GenePrediction position=GCSC_113:2996665..2998424 (+ strand)
ATGTCAAAAAAGAAGATTGTCATCAGCGAGTACAACGTGTCTGGTCTTCGCCTCAGGCCGTTCAACTTACTCTGGGGCGG
ACCTCTGCTGGTCAAGGACCGTAAATCTCGACAGAAGCAGCAAGAACAGGAGAGCAACACACAGCCACCGTCCGTCCTCG
AGGCTCCTCCCGCTGCAGAAGAAGCGCAGGCTGAAGCGCCTCCTCCGGCCGATCCTGTGATACCGGTAGAGCCTGACACC
CCCGCGGCAGGCACTGTGAAGATTGAAGCAGATACGAAAAGCAAAGAAAAAAAGAAGCACAAGAAGCATCGCCCCAAACA
GTACTACGAAATCGAAAGCGACAGTGACAGCAGCAGCAGGGGACGTCGCTATAGCTCATACAGGCGATCGCAATGTTACC
AATTTCGTCCCATCGGATGCCATCGAGATGGCTGTCAATGCTCGCATGATGCAGAGACCAAAAAAAGAGAGACGAAGCAC
AGAAAACAAAGCTTGAAAGCCATGCGATGTCCTGTATGCAAGCAACACGTGGACATGTCTTCAATTGAGGGCGATGACAG
CAGCATAGACTGTAGCAGCGACGCAACGACGGCCTATGTCTGTAAGAGAGACAAGAAAAAGAATAGATCAAAGGCAAAGT
CCGGGACACTGAAGAATGAAAGTGGGGGGAACACCGAAAAACAGAGAATTAAAGACGGCAACACCAAAGAAGACGAGCCA
CAAGTGCCCTCGTCCGCCACTGCTCTTACAGATGGTGATGTCGTCGCGGATCCAAAAGCCCAGAATGAAGTAGACGAAGG
CAACGCAGGCAACGCAGGCAACGCGGGCAACGCAGACCAGAGCAACGGTACAGTCGGTGGCGATTCCGTTGTCGTGGAAA
GCAACGTGATGCCGACTCTCCAGGATGCAACTAATCCTCTTCCTGGGGTCGATCTGCGTGCAGACTTCTTGGCCTCATCT
GGCGCCTATCCATCGCAGTTTCCCCCCAGCTTCCATCGCAGCGACCACAACGTGCCTTCATATCTGCCAGAGTTTGCAGA
CACGCAATCTCGTCCCTACCCCTACCCTTCCTACCCGGCATATCCCTATGGATATTGCCCGTATCCTATGTGTCCCTACC
CACACATGACACCTCCGATGGCTGGCTATTTGCAGCCTCATCTGCCACTGATCTCACCCTACGCCTCAGCGGGCGCTGAA
TTTGTTCCTGATGCTGATATGCAGGGAAATAGAGGCGAAGCAGCCGTTGCTGATGCAAACGCCCAGAACGATGGTGGGAA
TGGCTCCGCCCCATGGCATGACAAGGAACTGACCACTGGTGACAACATGAACAAAGCCGAAGGCGAAGACGAGGCAGTCG
AGACAAGCAACGATCAGATCGACAACTGGGGCATCAAATGGGACGACAGCGGCTTGGATGAGACCTGTGTAGGTACTACA
AACAACGGTTCCTGGAGTTGTAAGCCAGCAGACACCGAGGGCAGCGCCGATCGATCGCCGACATGGACGGCTAGCGACCT
AGCCCTACTCGGACGTCTGCACACTCAACAGGTCACAGACAGGTGGCGAGACCTGCAGACAGCGTTTTATAACGAGACCG
GGAGAATGGTGGACTTGGAAGTGCTTAAAAGCACGGCAGAAAACACCGATGATGGCCAGTAAGAATGTTTCGGATGAAGG
CGCCGAGGCGGATGAGAGGCTGAACAATTTGAGTCTGAAAATGCAGCGGCGAGGCTTGGGTCAAGAAGGCCATACTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62