GenePrediction:GLEAN_4135 Details

Name: GLEAN_4135
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:3008376..3009793 (+ strand)
Length: 1418
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:3008376..3008698 (+ strand)
Length: 323
Type: CDS
Source: GLEAN
Position: GCSC_113:3008796..3008950 (+ strand)
Length: 155
Type: CDS
Source: GLEAN
Position: GCSC_113:3009043..3009539 (+ strand)
Length: 497
Type: CDS
Source: GLEAN
Position: GCSC_113:3009592..3009632 (+ strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_113:3009700..3009793 (+ strand)
Length: 94
>GLEAN_4135 class=GenePrediction position=GCSC_113:3008376..3009793 (+ strand)
ATGGATCGTGCCGACCCGTTGGCAGAGCTGATCAGCAGCTACTTTGAGCTCAACGGTAGCGCCATTGATGAGCTCCTGGA
CCCGGACGAGGACGTGGACGGGAGCATCTATGCCGATCAGCAGCCGTATCTCGGGCATGGCCCCGGCCCCGGTCCTGGCG
CCGAGCCCAGCCCGCTCGAGTTCATGCGTTACGTTGCCCGCAACACGCCGTTTGTAGCCCGTGGTGCTGCCTCGTTGTGG
CCGGCTGTCACCACCTGGTCTGCCTCGTTTCTGCGTGATGCACTAGCCAGCCACTCGGTCAACGTCGCTGTCACTCCCAG
AGGGTGAGTTTCTGCTTTCTGCTTTATTATCTGTCTGTCTTCTGTCGAGCCTCCTACCCCTGTCCCTGTCTCTTCCGGCC
TCGTCTGGCTGACTGCATAGAAATGCCGACGCACCAACGCCCGGTCCGTCTGGAGCCCTCGTCTTCGCCAAGCCTTGGGA
GGAGAGCCAGCCGTTTCCCGACTTTCTCGACTACGTCATGCGCCAGGAAAAAGGCGAGCTGGACCCTGTCGCAGAAGTGC
GCTATGCCCAGACCCGTAAGTCCCCATTTCCCTTACTATGTATCGTCAAGAGTCGATTCTGTCCGATCTGGGAATTCTAT
GCGAAATTAGCTCACCGCCATGTCCAGAAAATGACAATCTGCGCCAGGAATATGTCGCGCTGTATGACCACGTGCAGAAG
AACATTCCTTTTGCCCGCATCGCCCTGCAGCGGCCGCCTGAGGCCATCAACCTATGGATAGGCAACTCGCACTCGGCAAC
AGCCCTGCACCGGGACAACTATGAGAATGTGTACGTGCAGGTCCTCGGCCAGAAGCACTTTGTGCTGCTGCCTCCGCTGT
GTCAGCCCTGCGTCAACGAGCAGCTCTTGCAGTCGTGTACATACAGGCGCCGCGAGGACAAGGCCGGCCTCGAGCTGTTG
CCCGACCGCCCCGACGGAAACGCTGTAGACATCACGGTCGAGGGCGGCGCCATTCCTTTTGCCACATGGGATCCGGACAG
GCCAGAAGAGAACACCACACCGTACTCTGCGCTGGCATTGCCCATGCGCGTAACTTTGAACCCGGGCGATATGTTGTATC
TGCCCGCCATGTGGTTGGCCATCCCTCCCTTCGTCCTGCTGCCAGTCCGTATCGGTCTTTCCCTGCTGACTCATCAGGTA
TCACAAAGTCTCGCAGTCCTGTCTAGGCGATGGCATCTGCGTCGCTGTCAACTACTGGTAAGAAGTGCCGCCATGGGCTC
TCCAAAACATGGACCGTTTGTGCTTGGCTGACTGAAGGATCCAGGTATGATATGGACTTCAATGGCCCTCTATACCCGCT
CAGTGCTTTTGTCCGTTCTGTTTACCAGACTACGCCGCAGTCAGGAAGAGCAGTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62