GenePrediction:GLEAN_4137 Details

Name: GLEAN_4137
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:3020441..3021898 (+ strand)
Length: 1458
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:3020441..3020587 (+ strand)
Length: 147
Type: CDS
Source: GLEAN
Position: GCSC_113:3020651..3021898 (+ strand)
Length: 1248
>GLEAN_4137 class=GenePrediction position=GCSC_113:3020441..3021898 (+ strand)
ATGGGTTCTAACGACGAGCTCATCAACCGTGTGCACAGCCTGAGCGACCTGGAACTGGCCGTGTTGCTGTCGCTGATCAG
CCAGGAACACTGTGTGATAGGGACGTCTGGAGTAGTCCTAGATGATCTTGTTGATGAGCTTTTCTTGGTATGCCGGCAGC
GCGCAGCTCTCGTGAAAAGCCTCTTGTTTCGCTGACCACACATGGCTCAGATCTCCTCAAAGGTGTTCGGCTTGCGATGT
GTCGTTGTTGACTGCCATAAGCATATGACTCTCGATGAATTCCAAGCCTCAATAATCATAACTGGCACTCTGTCCACACC
AACCGCAGCCACAGGCACCGGCAGTGGGCACGACGGGGCAGGCAATAGAAACAGCCATGATTATGTCCACCTGCCGGCCG
CAAGGCATGATCGTCTAGGTCCTCGGTCTTTGCGTTCGCCGCCGCCAGCCTTCCTCATGATGACATCCGCCAGCGCGACC
TCGACGACTACGTCACCAGCGGCCGCAATTCCCGCCATGGCCAATGTTATCCTGGCAAAGAATCTGAACCGTGCACCCGA
AACGGTGCAGATCCAAGCACTTGAGCTCTTGCGGGCCGGCGGACTGCTCCCACGCACAGCCGTCCAGGTGGCCCCGCGGC
CCTTTCTGTTCTTGGCTGTCGTCGCGGCTGAGCCCGGTTTTCGTTGGGGAGGCGGCAACGGCGACAAAACAGCAGGCAAA
AAGGAGGACGATGTCGAAGAGGACCAGCCGCCGCACATGACAGCATACCTCAACGACTTCTTTGCCATGGGCCACTGGCA
CAACCCAGACGACGGATTTCCCAACCTGGACGACGATGAGGAGGCAAGCCATCAGCAGGACCGCGGAGATGCAGCCAATG
ACAGTGACGGCAGTAGCGACGATAACGTCGACAGCATTGCCTTCAAGAATGGCGACTTGGGCAGCCGCATCCGCGGCGAC
AACAATGTTGCCAGTACAAGTCGTGCAAGTGCCTACAGCACACTCGATCCAGTACCCTTTCTCTCGGAGGCAGACAGGAG
CCGGCTGACAGCGTTGAGCCGCGACGTCCGCATCGATGTGGACGTTCTGCGCTACCAGATGAACGTGGTGGCATTCTTGC
GAATGCACCGGGCCGTGGCTGTGATCGGCAAAGGCTGCAGTGGCATCAGCAGCATCTCACCCACTGCCACAAAGCACTTT
GAAAAGCTGACGCAATGCTTGGCACCGCTGCATCAGTTGGATTACGTCACCCCCTCACTCGTCGCATTGGCTGCCCGGAA
GGTATACCTACACAGGATCCGGACGGTTGAGACAGGCGATAGCTCCGCCGGAGCGGCTCTGCAAGAGCGAAGCATGCAGT
GGGGTAGTACGCGAGAAGCCGTGGAGGCGATGCTCGATGGCATCAGTCCCGAGGGCATCATCGAGGAGGTGTTGGACGGT
GTAGCACCACCGGTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62