GenePrediction:GLEAN_413 Details

Name: GLEAN_413
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1630505..1633735 (+ strand)
Length: 3231
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1630505..1632622 (+ strand)
Length: 2118
Type: CDS
Source: GLEAN
Position: GCSC_167:1633130..1633735 (+ strand)
Length: 606
>GLEAN_413 class=GenePrediction position=GCSC_167:1630505..1633735 (+ strand)
ATGTCGACATTTACGTCCGCCGTCGGCCTTCCTCCGCTCTCCACCATTGCCCCCAACGTGGCCCACGAATCGGGAGCATC
CATGGCTGTTGGCGGGTCCGCACTCAGCTCCCTGTCCGCCATCGAGCACCGCGATGCCCGGATCAAGGATCCCGTGCCCA
AGAAGCTCAAGGGCCAAACCGGCAACATCAAGGGCAACTTTGGCGTCATTCAGATGGACCTGACCGGTCACGACACGTCC
GTCGAGCGAAACGAGCTTGCCAAGCGGGCTAGCGAGAGCACCGAGATGGCCGCCCTGCGCGCATACCAGAGCGGCCACGG
TGTTTCCTCGTCAAAACGCTTCGTCCGCCTCCCCGACGAGCCGCCCTCCTCCGTCTGGGATCCATACTACATCACGACCA
CCGCCACGGCCCAGGCCATGCAGCCGATCCAGCACGTCCAGCCGGTCCAGTCTGGTCAGAACAATCACAGTACACAGAAC
AGCCAGGCTGTCGGCCCGACATCCCGCTCACAGTCACTGAGTCCCGGCGAGACAAAGGCAGAGCAGAAGCGTCTGCTGGC
TCTCCTCCGCAGCCTGCCGTCACCGGCTGTTGTGGACCAGATTTGCAAGGCAGTCGAGTACTTTGGTGGCAGCCCCAGCG
CTGCACCGCCAACAGACGGAGCGTTTCCGCGAAGCGACCTCACAAACGGTCTCGGCAGCACGTTCATCGGTTGGATCGCC
GAGATCTTCCCCAGGCTTCCAAACAGCACAACGAGCGCGATCACAGCCGTGCTGACATCACCCCACTTTGCGACAGCAAA
TGGAAGTACCACGTCTGCGAGGCTGGACCAAGCAGCAGGGGACTCACACGCACCGGGAGACTCGGCCATGGCCGGTGCCC
CTGCTGCGACAACAGAGAAACGCCGGAGGGGACGGCCAAAGGGAAGCAAGGCTACCAAGGTCAGAAGGGACAAGGGCATT
AAGAAGGGGCCCATGAAAGCCCGCAAGGCTGCTGCTGCTGCAGCCGCTTCAGTTGCCAACGGCGAAGGCAGGACGACCGA
GGAGGATGGCTGGGTCGACGTGGACGACACGGCGATGGACGTCACCGGCGGCGTGGCAGACAGCATGTTCTTCCACCCCG
GCACATCGATATCCACACCCGAGCGGCAATCTGCTCCCGCTCTGTCCACACCGTCAGCGAGCATGGATGTCGGTACAGGT
GCTGGTCCAGAGGTCGGTGCAGGCACGGCTGAAGGAAAGAAGCGCGGACGACCAAAAGGCTCCAAGAACCGGCCAAAGGC
AGCGGACGTCGTCGAAGCTCCCAGCAGTAGCAAAGAGATCCCCCCGGCGCCTGCTAACGTCACGCCCATCTCGCCGCCCG
CTGTTCCGGGTGCTTCTACGCCGGCGAAGAAGGCACAGATTGGACGACCAAAGGGCTTCACGGCGAAACCAAAGGAGCTT
CCGACTCAGACGACATCCCTCGGCAGTGGCAGTGACAACGATTTCGGCCTGTCCCACCTGAACCAGCAGATGTATGCTGC
GTCTGCTTCTGCTGCCGTGCAGCCCGCGGACGCTGTGAGCATGGCCACCGGGGCCAAGCGCAAGCGAGCAAAGGCAGTCA
AGAAAGACGAGCTTTCCTCGGCCGACCTAGCACAAGGCTACCCGACCGGAGTCCAGCAGCCTTCTGGCCAGCTTGCCGAG
ATAGCTAACACGAGCACGAACATGAACACGGCGAGCACGAACCCGTCTGCTGCGGTGAAGCGGCAGCGGAAGTCTGCCGA
CGCGAGGGCCTCGATGCGAGGCAGCAATGCTAGTAGCGCATCTCCAGCCACACAGGCCGCCGCTCACAGCATGGCCGGCA
TAGGCAGCGACCAGCAGCAGATTCTCGCTCCGCTCGATGCAAGCGATGCCGCCGGGCACCAGCTGAACGTCGCCTTTGAC
ACGCTGTCGTCCCTCGGACAGGCCACACAGCAGGCCGATCCCTCACAGTCGCTCGTTTCACAGCAGCCTCGCCACCAGAT
GCAGCAGCCGCAATACACCACACAAAAGGCCATGTCGGCCACACCACCGCTTCCGACCATCGAGCAGGGCCAGGCACAGA
GCGTGCAGAGCGTGCAGAGTATGCAGGCAGTCCAAGGAGTGCATGGGCTACAGGGAATGCAAGGACTCAATGCTGGACTT
TTGCAGGGCAGGCAGCATCCCCAACAGCACCACCAGCACCAACAACAGCAGCAGCAGCATCATCATCAGCACAGCTCGCA
GGCGCAGATGGCTGGGCCAATGGCTACCGGCGGTACCATGACCTCACAGCAGCTGCCCCGACCCAACAGAACGCCCCAGC
CGTCGTTTTATACTGCGAGCAGACCAGAGGCCACCCCGTTTGGCCAGACGCAGTCGCAACACCAGCAGCAACAGCAACAC
CAGCACCAGCACCAGCACCAGCACCAGCACCAGCACCAGCACCAGCACCAGCATCAGCATCAGCATCAACATCAGCATCA
GCAACAGCAACAGCAACAGCAACAGCAACAGCAACAGCAACAATCGCAAAAACAACATTTCGCACCACAGTATCAGCAGG
CCAGCCAATACACGCCACAGCAGCAGTCACCGGTGTTTGCACAACAACAGCGACACCCGTCTCAGAGCATGACTGTTGGC
TCGCCCGGTTTGCTGACTCCGAACAGCTCCCACCGATCGCCCCAGTTCACGACGGCGACGAGCACAGCAGGTCTGGGGAC
GACGCAGAACACGTATGGGGCCGGCTTCGGCTCCTCGACCTACGGTCAGCCGCGCCGGACAAACAGCGGGCCTGGGCCTG
CAGGCGCCGGATCGCCGTCCCTCAACGGGCCCTACGGCACAGGTGGCAGTGCTGCTGGAGCCACTTCGGTACCGCACAGC
CTCTCTCACCACGGCTCGCCCTCCTCCTTTGGGGCGACAGCACGACAGCAGCCGCAGCCGCAGCCGCAGCCATCGCCCGG
AAGCGCCGGCAGCTCGGCAGCCCAGGGCATCCAAGGCTTTCACAACTTCGACAGCCAGTCGCTGTTTGACGGCATCGGCC
TGGATGGCAGCACCGGCAGCGGTGGCTTGGGTCTCGGCGGCCCAGGGACCTATAGCTTGGGCGGCAGCGTGCCGAGAACA
TCGGCCAATCCGGCATCAGCATATGGAGCCCCGCCATCGATGACCTCGTTCGACACAAACATCCGGACAGCCAGCCAGCT
GCGGGACCGCTTCTACAACATTCGGCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62