GenePrediction:GLEAN_4140 Details

Name: GLEAN_4140
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:3037878..3040224 (+ strand)
Length: 2347
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:3037878..3037958 (+ strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_113:3038030..3039304 (+ strand)
Length: 1275
Type: CDS
Source: GLEAN
Position: GCSC_113:3039364..3039430 (+ strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_113:3039502..3039530 (+ strand)
Length: 29
Type: CDS
Source: GLEAN
Position: GCSC_113:3039590..3039652 (+ strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_113:3039711..3039746 (+ strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_113:3039804..3039948 (+ strand)
Length: 145
Type: CDS
Source: GLEAN
Position: GCSC_113:3040000..3040149 (+ strand)
Length: 150
Type: CDS
Source: GLEAN
Position: GCSC_113:3040202..3040224 (+ strand)
Length: 23
>GLEAN_4140 class=GenePrediction position=GCSC_113:3037878..3040224 (+ strand)
ATGGCAGACTCGGAGCCGCCGGCACAGCCGCCGGCACAGCCTGCCGGAGACCTGCACCTGGACGAGGTGACGGGCGAGAA
GGTGGGTGCCTCTCCGAGACGATAGACAGACAGGGAGAGACGAGGACTAACGGAAGCCAACAACACCTGCAGGTGTCGAA
GACGGAGCTGAAGCGTCGACAGAAGCAGCGGCAGCGAGACGAGAAGAAGCAGCAGAAGGCGGCCGAGGTGGCGGTCACGG
CGCCCAAGAAGACGACCGGCCCAGTGCCGATTGTCGAGAAGGACCTCGATCCTCGCGAATACTACAAGATCCGATGCCGG
CAGATCAAGGAGCTGCTCGACACTAACGAGCCAAACCCGTACCCGCACAAGTTCCAGGTCAACTACGACACGTTCAACTT
TGCGCGCGACTTTGAGCACCTCAAGTCGGGCGAGGTCGACAAGACGCGGGAGATCCGCGTGGCCGGCCGCATCTTCACGA
CGCGGCGGTCGGGCGTCAAGCTGATCTTCTACGACATCCGCACGGGTGCGGACACCAAGTCGATCGGCACGCGGCTGCAG
GTCATGTGCCAGTCGCAAAACGTCAAGGAGGGCGGCGTGCCCTTTGACAAGCAGCACGTCCATCTGGCCCGCGGCGATGT
GGTGGGCATTGTCGGCTGGCCAGGCCGCACGGCACCCAAGAGCCGGCTGGAGAAGGGCGAGCAGGGCGAGCTGTCGATCA
TGGCGTCGGAGATCGTGCTGCTGTCGCCGTCGCTGCACATCCTGCCGTCTGAATACTACGGCTTCAAGGACCACGAGCAG
CGCTTCCGCTCGCGCTACCTGGACCTGCTCTTCAACGACGCCTCGCGCGAGACGCTCTGGAAGCGCAGCCGGATGATCAA
GTACATCCGCGACTTCTTCAGCACCCGCGAGTTCATCGAGGTCGAGACGCCCACGCTCGCCGCCATCGCCGGTGGCGCCA
CGGCACTGCCGTTCATCACCCACCACAACTCCCTGAACCGGGATCTGTACCTGCGTATTGCCCCCGAGCTGTATCTCAAG
ATGCTCATCGTCGGTGGCTTTAACAAGGTCTTTGAGCTGGGCAAGAATTTCCGGAACGAGGGCATCGACCTGACGCACAG
CCCCGAGTACACCAGCATCGAGTTCTATGCTGCGTACTACGACGTCTACGACGTCATGGCCATGACGGAGGAGCTCGTGT
CTGGACTGGTGAAGGATCTCACCGGATCGTACAAGACGAGCTTCACGACGCAGCATGGCGAGGTGTACGAGGTGAACTGG
GAGGCACCGTGGAGACGCATTGACATGATTCCAGAGCTCGAGAAGATCACCGGAAAGACCTTCCCTCCCGGCGACGAGCT
TCACACCGACGAGACGAACAAGTTCTTCCGCGAGCTCCTGCAGGAGCTGAAGCTGGAATGCCCGCCGGTATGTATTGCGG
CTGTTGACCGATCTAGCGTGAGGAATGCCAACTGACCATGATGCAGCCGCTGACCAACGCTCGCATGCTTGACACGCTTG
TCGGCGAGTATCTCGAGCCGCAATGCATTTCCCGTGAGTGCAAGATTCGACACTGTCACATCAGCTCGGCGTGCTAGCTC
AATAATACTGACACATCTTTCTAGCCGGATTCATTCTGAACCACCCCCAGATGGTTTGTCCACTTGCCTGCCCTTGAGCC
AGTCACGTCCACCTGCTGACACTGTGTTCTAGATGTCCCCTCTGGCCAAGTACCACAGAGACCGCAAGGGTCTTTGCGAG
CGGTTTGAAGCCTTTGTAAGAGTGCAACCACTGTAATAGAAAACAGTGACTGACAGCCGATTTCTGGGAATAGGTTTGCA
AAAAGGAGATTGCGAATGCATACACCGAGGTAAGGAAAGCCTAGAAGTAGACACACTATGCATATCAGTCGTCTGACTCG
TCATAGTTGAACAACCCCTTCGACCAGCGGATGCGCTTCGAAGAGCAGGCCCGGCAGAAGGCCCAGGGCGACGACGAAGC
CCAGCTGGTTGACGAGAACTTCTTGCGCGCACTGGAACACGGCCTTCCGCCAACCGGCGGTTGGGGTCTAGGTAAGATGT
GGCGGTGTGGCGTAAGCAATGGGCGAATGCTGACATAAGCAGGAATCGACCGTCTGGCCATGTTCTTGACGAACAACTAT
GCGATCCGCGAGGTGATCTCGTTCCCGATGCTCAAGGAGGATAAGCCTGGCCCGTCGGAGAAGTTTGCTGCCGAGGAGGT
AGATGTGCCTCCGATGCCAGAAGAGGGCATTCGTAAGTCTGAGATGCTTTGATATTGATGCTATCCTCTGGCCTGAAACG
ACAGCTGACGTTGCAGCCCACAAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62