GenePrediction:GLEAN_4141 Details

Name: GLEAN_4141
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:3042416..3043528 (+ strand)
Length: 1113
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:3042416..3043528 (+ strand)
Length: 1113
>GLEAN_4141 class=GenePrediction position=GCSC_113:3042416..3043528 (+ strand)
ATGGGTTGCCTACTGGACTTGGTGGCTCGCTGCAACGACTACATTCTCGAGGGCGTTTCTGGGGCCCAGGACTGGCTCCC
GCTGCGGCGCAAGACGGACGGACAGCAGTTTGTCGGTCAGGTTCTCTCTCTCGGCGACGGCAGAACATGGCTCGATCGTC
TGCTCACCGCGGGCCACATCGATCCCCCACCGGGTCAAGATTCTGATGCCGACAACGACAACGACAGCAATACCTTTTAC
CGCGCTTTGCAGCGACTCCTCCGCCACGACAATCTCGTCTCGATCGCGGCCTTTGTTGCTGTGCAGCTACTGGAAAGCGT
GACAGCACAAGTGGCAGTCGTCTGGGACCGATGCGATGCCGGTTCGCTGGACGTGCTGCTCCACGACCTACCGCGTATGG
CTGAGATGGGCGTGTATCGGGGCGTGGTTGGCTGCCGGGACGAGGGCACCGTCTACCTGCCCGAGTCGTTGTGTTGGCAC
GTCGTGCGATCTGTCCTGCGGGCGCTCTCCTGGCTGCATGATGGCGACGGCAACCCGGTGCAGGACGGATGGATGCCGGT
CCTGCACAATGCCGTGCAACCGGCCAACATCTTCTTCCAGCACCCGCGCGGACGCGAGACGTACGGTCTCTGCAAGCTGG
GCAACTACTCGCGCTGCTTCGTGTCCGGCCACATTGTCGGGCCGCACGCACGCAGATCCCTGGCCATGAAACCACCCGTC
GCACTCGCGGCTGCTCCAAATCCACTCTCCGTGCAGGCCAACGACTTGGTGACGCGTGGCACCGACATGGCTGCGCTCGG
CGAGGTGCTGCACCATATGATGACCGGTCGGCCCTGGACAAGCGCAGCCAGAAAACTGGACGACCAGCACAACGAGGCCC
GGGACAAGGACGTCGCAACGGATGCTAACGCAGGACTCGAGGGCCAGACAGAAGCAGAGGACGGCGACAAATACACGCAT
CAGCTGGAGCTGTTTCGAAGGCGCCTGCTCCAGTTCGCAGACCTGCAGAACTGCCCGGCCGAAGCTGGCACAGCAGCCAT
GCTGCTCGAACAGGCCCGTCTCGGCTTCGAGGCTTGGCGCAGCAGCACGCTCGATGGCCGGCAGCACGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62