GenePrediction:GLEAN_4143 Details

Name: GLEAN_4143
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:3060037..3061961 (+ strand)
Length: 1925
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:3060037..3060093 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_113:3060189..3061961 (+ strand)
Length: 1773
>GLEAN_4143 class=GenePrediction position=GCSC_113:3060037..3061961 (+ strand)
ATGCCGTTCGACCAAACGATTACCATCATCAACAATTCCGGCAAGGTGATCAGCACGGTACGTTTGCTGTTTCCCCACGC
GTCGGCCCATGCGTCTTCCCCACGTTCTTACCTGCCGCTCCCGCTCTCACAGCGTCTCTGACTCATTGACAGAGCAAGCA
TCTTGTCGGCATCTTCAAAGAGGCCAAAGCTGCTTACCGGGAGAAGAAGGGTGCACTCAGGCAGGAGAAGACTGGCGGCT
TTGGCCACGCCCAGGCTTCTCGCGGCCCGCCTGGCAATACCGGCAAGGGCCCCTTCGTTGAAGAGTATGATGAGGGGAGC
GGCTTGGACGACCGCGAGTATGGCTTCCGCGGCCTTGGAAACGCCCGCCAGCCGCTCTTTCTCCAGGGCGGTGGCCGTCT
GTCGCAAGACAGTGGACGACATTCCGGCGCCACACCGCAGAGGCCGCACGCTCACCAGCCTCGCCGCAGCAGTAGTGTCG
GTGGCAGCAGCCACCACTCCAAGTCACGTCACAGTCGACATCGTCCCAGCCAGGATAGTCCCCGGCCGCCGTATCCGCAA
CTGACCGAGGGGAACCTTCGTTCCCATTCCGAGGTCTCGTCTACGGCGCCATCGTCTTTGCCGCCCCGCCGTCTTCTGGC
CGCTGCCGGCCAGCCGGACTTCCAGCCACGGCCCCTCGTTCGAGCGCAAACAACCCCGGCCGCTCCCGAAAGCATCGTCC
CTCAGACGGCGGTCGTGGTTGCCCGGCCGAGATCCAATACGGCACTTCGGGATTCTGGGGCAGATCAGCTCGATATGCAT
TTGGCGTACGGTGATTTGCCCCCCGACCTGGACACGTACCCCGATCCAGACGCTGGGGCGGCCAAAAGCGAAGACGAAGA
ACAGAAGAAGGCCCAGGCCAAGACGCTCATCGATTACATCGAAGCCCTTCTGGACGAAGCCGAGTGCATTCACCACACTG
CCGCCTCTATCATTGCTCGCCTGCAGAACAGCCCGGAAGCAGCGGCGGCTGTTGCTCTGACCCTGGCCGAGCTTTCAGCG
CTGCTCGCCAAACTGAGTCCGACCTTTTTGGGCATCATCAAGGGCGGAAGCCCGGCGGTGTTTGCCCTCTTGGCCAGCCC
ACAGTTCCTCATCGGCACCAGCATTGCCGTTGGAATCACTGTTGTGGCATTTGGCGGCTGGAAGATCGTCAAGCGCATGA
CCGACGGCAAGCAGGCCTTCGAGGCAGCCAGCTCTTCGCCGGAACAGCAGCGGCCGTCCAGGCTGCCAGCTGGGCCGTCT
CTTGCTGGTGTGCAAATGCACAGCCTTCCTCCGGCTGTCGACAGGACAGCTCCGACCGTGATATCTGACGGCTTTGACGA
GGCCGTCGTGCTGGAGGAGGAGCTCAGCTCGATTGAAAGCTGGCGCCGCGGGATTGTACCCCCAAGCGGCCTCGAAGACA
GCGCCGTCGATGCCGAGCTCATCAGCCCGCAGGCGATGCGCTCGCGCAATGGCGACGACGATACGCACACCGTGCGAAGC
TCCAGGACTCACCACAGCAGCCGGTCGCGAACCGACACCAGCTCCCAACGGAGCAGCCATAGCCACCATCGCAGCAAGCG
CCATCAAGACCAAGGCCACGGCAGCGCAGGCACCCAAGAGGCAGGCAAAAGCAGCAGAGGATCGGTGGTCGGAGCGGCTT
CTGTTGTCTCTAGTCATCACTCACGGCGTTCTGAGAGCCGCGCAGTCGAGCGGTCCAAGTCTGGCAGCATTGTCTCTGCG
TCTTCCGCATCGCCGTCATCGCCGTCGTCTGATCAGGGCACTTCCCGCAGCAAGGAAAAGAAGGTGAGCAATAGTGGTAA
CATGCTGAAACAGCTGTTCAAGAAAAAGAGGGAGAAGGACAACAGAAACGGAGGGGACGGTCACCGGTCAGTTCTGGGTA
GATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62