GenePrediction:GLEAN_4145 Details

Name: GLEAN_4145
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:3075451..3076274 (+ strand)
Length: 824
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:3075451..3075491 (+ strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_113:3075560..3076274 (+ strand)
Length: 715
>GLEAN_4145 class=GenePrediction position=GCSC_113:3075451..3076274 (+ strand)
ATGAATGATCTGATGTCATTTGGCTGGCATCGTGTATGGAAGTGAGTATGCAACCCGTAACCGGCTGTAAGGTGCCCCTT
TCTCTTTTGCAACCTAACAAATACACCAGGGATCATTTCGTCAGCTCACTTAACCCTGGCTTCACAGTGGACCATGTATC
AGGCCAAGCTGCGACACCCCAACGTATTCTTGACGTCGCTGGCGGCACCGGAGATATCGCCTTCCGCATGTTAAGGCATG
CGCATGCTATCAACAAAAATCCGAACACGCACGTAACAATATCAGATATCAATGCCGCCATGTTGTCTGTCGGCCAAGAG
CGTGCCCAGTATCATCTTCCTCCCAGCCAACAAGCAGCGCTCACCTTTTTGGAGGCCGATGCTACTAGCTTTTGTGCACC
AGACGGCAGTCATACTGTGGCGTCATCTAGCACAGACCTGTACACTGTGGCATTTGGGATCCGAAACTTCTCCGATATCC
GCGCAGCACTGCGTGAGGCATACCGAGTCCTGCGACCAGGCGGTGTTTTTGCTTGTCTTGAGTTCAGCAAGATAGCTTCC
ACGGACAGCAACCCAGCAGCAGCCTTGTTTGACGCTGCTTACAAGCGCTGGTCTTTCAGTGCAATCCCCATGATCGGCCA
GCTTGTCGCTGGTGACCGGGACTCGTACCAGTATCTAGTGGAGAGTATTGAGAGGTTTCCAACCCAAAACGAGTTCCGGG
ATATGATTGTGGATGCTGGCTTCGCCGTTGCTGGGTGTGGCTATGAAAACCTAACAGGTGGTATCGCAGCCATACACAAG
GGTATGAAGCCTATGAATAACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62