GenePrediction:GLEAN_414 Details

Name: GLEAN_414
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1640940..1642272 (+ strand)
Length: 1333
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1640940..1641161 (+ strand)
Length: 222
Type: CDS
Source: GLEAN
Position: GCSC_167:1641312..1641933 (+ strand)
Length: 622
Type: CDS
Source: GLEAN
Position: GCSC_167:1642004..1642272 (+ strand)
Length: 269
>GLEAN_414 class=GenePrediction position=GCSC_167:1640940..1642272 (+ strand)
ATGTCTACACACACCAGGTTCTCAACCTTCCCACCCACCCCCGGGGGTGATGACGGCGATATCGGCAGGCCAGAAAGCGA
CAGCCCGTCCTCCAAGCTGATGCTGGAGCCGTATTCCCCGCCCTTCGTGGTGGAGACGCCCACGTCACCGTCCTCGGCCT
TCGCTCTGTCGCGGTTTGAGTTTGAGACGGGCAGGGGAAACGAGGGCACCAAGATCCTGATGGTCGAGTGGAACAGCACT
GCAGCAACTGCAGCTGCAGCTGCAGCGGCAACAACAACAGCAACAGCAACGACAGCGACAGCAGCTTCTACCGTTACTAC
CAGGCAGGACAATCCGACGACGGACAACACTACGAGCTGCCTAGCGGTCCAGGACGACGGCCACGACTGGGCCGGTTGGG
AGGTCACGTGGGACGGCAAGACGGACGCCAATGCAGTGCCCGCCCGAAGAAGCACCGGCGGCACTGACGGCGAGGATGGC
ACGACGCTGCGGGTGTACTTTCTGCTGCCGCCTGGCCAGCACATCCCGCCGCTGGTGAGCATTCGCCAGCGCGTGGGCCG
CGTGGGGGGTGATACCGCAGCAGTCCTGTGGACCAAGCCCATGCCGGCTATCTTTCCGGCCAGCAGCAGCACGACGACCG
GACAGCGAGGCGTGCTGCATACGATATGGGCGCAGCAGCGACTGGCCGACCTGGCCGCCGAGATTGCGGCCGAGATGCAG
GCCAACAGCGAGAGTGTCGGCCTGCAGATCGCCATCCAGGAGCACGCGTGGATCACAGAGCACTTTGGCAATAGCAACGA
CGCAACGCCGGCTGCAGCTGCAGCAGCAGCGCGATCACCATCCGAATCGGAACCGGAAACGGACACAGACACAGAAGCAG
CTGCCGCTTCGTTCTCGCCACACCCTCCATCCGGAAATACGAGCAAGCTCGGCGAGAAGCTCAGAGGCCTGCGGCTGGCG
ACGTCACCGGCCGACCTCGAGGCCGCGTCACGAGGTGAGTCTCCTCCATGTCGACATAACAGGAGCCCTATCATCCTCAC
CCCACCCCCCTCCTTTCTCCCCAGCTGACCTCCCGGGAGCAAGCAAAGGATCCGCCAGTACCACCCTCTGGACCCACGTT
CACGCCACGCAGCAGACAAGGTCGCAGCCGCAGCAACAGCAGCAGCAACAGCACACGGCCCCGTCACACGTCTACTCCCT
CGATGCTGTTCTGCAGGGCGGCCGCATCCAGGCAACCGACACGGCAGATGCGGACGGCGAGGATGAGCTGTTTGCCCTGC
CTATGAGTCCGCGCAGTCCGGACATGGTGAAGAGCCCGTTCAGCGTGCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62