GenePrediction:GLEAN_4150 Details

Name: GLEAN_4150
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:573365..569230 (- strand)
Length: 4136
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:573365..573011 (- strand)
Length: 355
Type: CDS
Source: GLEAN
Position: GCSC_160:572944..570715 (- strand)
Length: 2230
Type: CDS
Source: GLEAN
Position: GCSC_160:570654..569645 (- strand)
Length: 1010
Type: CDS
Source: GLEAN
Position: GCSC_160:569540..569366 (- strand)
Length: 175
Type: CDS
Source: GLEAN
Position: GCSC_160:569254..569230 (- strand)
Length: 25
>GLEAN_4150 class=GenePrediction position=GCSC_160:573365..569230 (- strand)
ATGACTCCAGCAATAAACAATACAGCCAGAAAACTTCAGGAGAGCCGCGGGCTGAGAGCCAGAGCTCCAGTTGCCGCTCA
GTTTGAAGACTGTTTTCAGGCCTTCGTTCAGCTTTACGATTCTCTGCAAGCCAACTCCTGCAACTTCGATTCCACACCCA
GTCTCCCTCCCGAGAACGGCGCCGACGAAATCCCCCTTCATGAACGTGCCGAGTATTGCAGAAGAACTTTCAGCGCATGG
GGTAACGACAGCGGGGCGTCATCGCGCGCGTTGGACCATGCATTGAAGGAATCCCCGTCGTTGATGCAGCAGACGTTGTA
CCTCCTCGGCGAGCTGTCAACAACTTTGGAACGAAGTATGTCAAAAGTGTCGTGCCGGTCATGCATTGATGCTGTATCTG
TATCCAGCTAACGATGACCAGCAAAAGCGAGAGTTCTGCAGATTGAGAACGACAGGATCCTCAGTGGCAGAGTCGTGGCA
GACGACCAAGACGCAGAAACCAGCACTGAAGCGTACCTTGATGAGATTCAAGATATTCTCACATGTCTGCTCGAGCTTCT
CCCGGTCCTGCGATATCCAATGGTGGAAGAAACCGGCCAGGAACTTCTTCAAATTTACGATCCAGCACTTTACCCTGAAA
GAATGTATCGAGACGTCGCAAGGACGATGTTCCCTCATGCGCCTGATTATTTGTGGAATCGTCTCGCCCAGAACAATATA
CGGGCAAGAAAGAGGCTAGGGAAGTTGCGGTGCAGAAGCAAGGGCCTGATGACGCATGCAGACCATAAACAGCAGACCAA
CAGTCTCATGTTATCACGGGCTGAGTATCCTCTCTATCCACGGGGTACCTTTAGATCGCCTTACTCATTCTCGTCATCTT
CGAACTTTGCTGCAACCGAATCCGATGGTGAGCTGACCGTGAAGGGGCCGCATGCCTATTATGAGAATTCAGGTGCCTCT
GATATGGATGCGTCGTCTATGACCTCCACCATGGAATCGCAGCCACATGTGCTGCAACAGCAAATTCTCAACCATAGGCT
CCCAGACAATCCGTCTCGCCATGGGGACTACGGAAAAGCCGAATGTCCTCTTTGCCATTTTGACTTGCCAATGGCAGATA
TTTCTGGAGACCTGAACGACAAGGAATGGGCCGCTCATGCATATCTCGATCTGAGACCATACGTGTGCACCTCTGATCAG
TGTGCACTCGATAACATACCCTTCGGCGACAAGGATATGTGGTTCCAGCACGAGATGGACTTCCATCGTTCTAAGATGGA
ATGGTCTTGTGTCTACTGTTCTGTTGCTTTTAGAGACGAAAAAGAATTCGAGGATCACCTTCTTTCAGCCCACGGCGGTC
ATGCAGCTTTGAACAACACTTCTCTCCTGATCGATAGTTGCAAACGCTATTCGGCCATTCTCGCCTCCGTTCACATTTGT
GATATTTGTCTTGGGCAATATAACAACATCAATTCTCTGAAAAATTGTCTTGCCGGCCACTTGGAGACGTTTGCGCGCGC
TACCACACTTGGTATAGACCAGATTGGGGCTGAGCAAAACGACTATGTAAAGAGATTTATCGCAGAACAGCGCAAGATCC
ATGAAAGCAGCGATTTGGGAATCGATAATGCTCTCTTCAATTCCAGCTTGTCTGCAGACGACAATGAAAGCAAAGTGGCA
TTGTTCGTCAAAAATCAGCAGCACAACGCCGCGATGCTACGCTGTAACGTCCCCAATCGTGACCACCAGTTCTTTGGCAG
ACATGACAGCTTGTCGTCTGCACATCTCACTTTGTCAACACTAAACAGGATGTGTACAATCACTGGCCGTCCTGGTATAG
GAAAGACGGCCGCTGCTATTGAGTACTCATACAAGTACGAGTCTGCATACTCATACACCTTCTGGGTTGAGGCTGAAAAT
GAGGGCCGGCGTGCCGAAACATACGGAATGATTGCTGCAAGCCTCAAGTTGGACAAGAATGCAATTCCGGACGAGAACTC
CCGGACGTATATCATCAGAGACGCTTTGACAAATACGGACAAAGAATGGCTACTCATCTTCGACAATGCTACCAGTTGGA
ATGACATAGCTCGATATATTCCACCAAACCTGGCAGCCACAAAGGGTTCTGTACTCATTACTACCCGCGACGATAATGCG
CTATCTATTCCGGTCCGGTTTCATCACAAGTCTGTAAGCCTAGACGCCTTGCCGTTGGAAGATGCATGCAGGTGCCTTCT
TTCTGCCCTTCGTCCGGGACTGGGTGGAGAAATGTTGGAGTACCATCCAAACTACCAGCTAGCAACAAAAGTAGTTGAAG
TCGTAAAAAGGCTCCCACTGGCAATCACCATTGTTGTGGGCTATGTCAACATGTCACGATGTACGCTGGATGAGTTCCTT
GAGATGTGGGAGGAAAATGATTCCCGGATGAGGAAGAAAAGAGAGGCGCCAAAGTTGTTCGATGAAACTGTAGAGGTTTA
CGGCACAATCGATGCTCTGTGGGAGATCGGAATTCGAGAAGTCGACAGGAACAGCAGGCGCCTCCTGGACATCATGTCGT
TTCTAGATTCAGAAGGCACGCCGAAAACCCTTCTGATTGGTGATCACAAAGAAGAGTTTCTCGAATTTTTGCATGAGTCC
GAAACCATAAGGTGGGCATCGCATTCCTTCCATCTATTCGGTGTGCATGCAGCTAACCTTCACCCTCGTAGTTTCAAAAG
AATGATCAAACAGCTGAGCGGCCGTCGGCTGATTCACGTGAAACGGTCTGGGGATGATGAACCGAGCTACGGTATACACA
GGCTTCTCCAAAAGCAAATCCACCTTGATATGAATGATTACAGCTTCGCCGACTCTTTCCGGAAAGCTTTTCATCTGTTG
CGCAAGCGGTTTCCCCGGGCAGACCCAGCCCAAATCCCTCGACCAGCAACCTGGGTCATCTGCGAGCAGTACATGCGCCA
TGTGTCGAGCTTTCATCGCACATTCATGAAGAACTCCCACAGAACTACAATCGATAAGCTCAAGACATTAGAACTAGCTG
AGCTATTCTATGATGCCGGGTTTTATGTCTGGTCTCGCCAAACTACTGGCTACAACGGCCTGGATTTTTTGGCGAGCGCG
GAAGCCATTCTCAATGACAACAACTTTGAGGCCGACGAAATGCTCCGTGCAAACATCCACTGCATGACGGGACTCCTACT
CCTGAATATCGGGGTCATGGGTCGTAGGAAGGGTACCGAGCGCCTCCAAGAGGCCAGAAGAATTCGCAGAATCATCTTCA
AGAAAGACCCCACCCGGCAAAAAGATGTCATGTACAGAAATGCGACGAATGACTACGCTCTCTGTCTTCTCAACAAGCAC
CAGTTCGACGAGGCAGGAAGACTTTTCAGAGCGTGCTTCGAGAGATACCAAGTTTGGGGTAGTGAGAAGGACAACCCTTT
TGAGTATTCAAAATACTACGGCAACTACAGTGTGATTCTCATGTGGCAGGGAAAGACTCAGGAAGCGATCGATTCTATGA
AGAGATGCATGGAGTACACTGAAAAGTTCAGCGGTAGGAAGGCGCAATATTACCGCCGCCAGTTCATGCTTGCCTGCCTT
CTACTCCAGCATGGAGATGAGCAAGGCGCACTTGACATGCATCTTACAACTCTCAAGGCTCGGCTTGAGTTGCACGGAAA
ACTTCATGAATTCACCATGGATAGCACGTATGCGGTCGGTCGTACGTACTACCATATGAGTGATTATCCCAATGCTATGT
AAGCCTGAAGTCCTCGCTGTCTGAAGTCAATTTAAAGCTAACGTCCTTTCACAGAAAATATATAGACACTTGTATTGAAT
GCGCAAAGAATTCCAAATGGCCCGAAGAAGCCCTTGGCAGGGCAAAGCTTAACCTGGCCGAGCTGTACGAAAAGGAGGGA
ATTGGAGGAGCAAATCAAATACAGGCGTTGCGAGTGGAAGCAAAGGTGGTCTCGGACAAATACTCGCAGTACACTGCGAG
GTGTGTTCGTGAGGGTGACAGTGATTTGGCTCTTTTCGACGATTTGCAACCGACGTTCTTAGGGCGATACCTAGGGCGGA
TGCTTTTGACTACTCTTCAAAACGATTACAGACAAACTGGTACAAACGACGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62