GenePrediction:GLEAN_4151 Details

Name: GLEAN_4151
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:552903..549970 (- strand)
Length: 2934
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:552903..551849 (- strand)
Length: 1055
Type: CDS
Source: GLEAN
Position: GCSC_160:551785..549970 (- strand)
Length: 1816
>GLEAN_4151 class=GenePrediction position=GCSC_160:552903..549970 (- strand)
ATGGACGAGTCCAGACAGGGCCTCCTCCAACCCGAGAGAGAGGCCCGGAGCTCTTCTGAGGGCAGCGAAAACGATCACGA
ATCCGATCTCGACGTCACCGAATACCTGAGCTCCGATGCAGAACTCCAGCGCAATTCATTCTTTCTGCTTCGATGGCGCC
AAGCCTGCCTTCCTCGACGATGGGTCCGATCCCGACACTGTCTCGTCGCTCTGATCTCGTCTACGGTCTTGATTGCCGTC
TTCGCTATTGTCGGTGGATTCGCATACAAAAAGGTTGCGGTAGAGCCAGAGTACGGACTGTCGCCACCTTGGTACCCCAG
CCCCAAAGGAGGAACGGCCAGGTCGTGGGCAGCGAGCTACCAAAAGGCATCCGAAATGGTCCGCCGTATGACGCTTGCCG
AGAAGGTCAACATCACAACCGGCACCGGCTGGGAGATGGGCCTGGCCGTCGGTACAAATGGCCCTGCGGTCAACGTTGGC
TTTCCCCAGTTGAATCTTCAAGACGGGCCTCTCGGCCTCCGGTTCGCAGACAATGCGACGGCACTGCCGGCCGGCATCGC
GGTGGGGGCCACATGGAACAAGCAGCTCATGTACTTGCACGGCAAGGTCCATGCTGAAGAGGCCCGCGGAAAGGGCATCA
ATGCCATCCTGGGTCCGTGTGTCGGCCCGCTGGGTCGATTGCCAGCCGGTGGCCGGAACTGGGAAGGCTTTGGCTCCGAT
CCCTACCTGCAGGGCGTGGCTGGTGCCCAGACGATCCTCGGCATCCAGAGTCAGGGCATCATGGCCACGATCAAGCACTT
TATCGCCAACGAGCAGGAACACTTTCGGCAACCGTGGGAATGGGGCCTGCCTAACGCTCTGAGCTCCAACATTGATGACC
GGGACTTGCATGAGGTGTATGCTTGGCCTTTTGGCGATGCCGTCAAAGCCGGAGTTGTCAGTGTCATGTGCAGCTACAAC
ATGGTCAATAACAGCTACGCATGTGGAAACTCGAAGCTGCTGAATGGCATCCTAAAAGACGAGATGGGCTTCCAAGGGTT
CGTCATGTCTGACTGGTAAGCTCGCCGTGCGGTGGATCTGCCGATTTGCACGCTGACCTGACACCTCTCCTCTCTCAGGC
TTGCCCAACGTTCTGGCGTCTCGACCGCTTTGGCTGGCCTCGACATGACCATGCCTGGCGACGGTCTCGGCTGGCAGAAT
GGCCAGTCTTTGTGGGGCCCAGAACTGACGCGATCTGTTCTGAACGAGTCTGTCCCGGTCGACCGTCTCAACGACATGGT
CACCCGCATTGTTGCGGCATGGTACCAGATGGGCCAGGATGCACCGTCTTTTTTCGATGGCGAGGGGCCCAACTTCTCAT
CCTGGACAGACAAACAAATGGACAAGCCGTTTCCGGGCAGTCCGTCGCCTCAGACGCTGGTCGAGGTCAACAAGTTTGTC
AATGTCCAGGGCAACCATTCCATCGTCGCTCGCCGCGTTGCCGCAGAAGGCATCGTGTTGCTGAAAAACACAGACGGCTA
CCTACCTCTGGGTGTCGACGGTGTTTCGTCTTCCCAGCACCACGTGGTCAAAACGAAGCATAGATCAAACTCCACAGCTG
CCGGCGCAGCCAAGGTGAAAATTGGCATATTCGGCGAAGACGCCGGGAGTGGTCAAGGACCCAATGCCTGCGTTGACCGT
GGCTGCAACCAGGGAACGCTTGGGTCTGGCTGGGGCTCTGGTGCTGTCAACTTCCCGTTTTTGGTCCCTCCTGTCGACGC
TCTTCATGCGGCCTTTGACAAGGAAAAGGTTGACCTTCAACAGCACCTGATCAACAAACCCAAACCCGAGACATACGCCG
ATATGGACGTGTGTATCGTCTTTGCCAACGCCGATGCAGGCGAGGGCTACATCTCCTCGGGAGGTATTGCTGGCGACCGC
AACGACCTCCTCCTGCAAAACGGAGGTGACGACTTGGTTTATGCCGTGGCAAACGGCTGTGGCCATGGAAGTGGGAAAGT
TGTCGTCGTTATCCATGCCGTTGGGCCGGTGCTGGTCGAGCGGTGGATTGACCTGCCCAACGTCAAGGCCGTGCTGCACG
CCCACCTACCCGGCCAAGAAAGCGGAAACGCCATTGCAGACGTGTTGTTTGGGCTCGTCAACCCCAGCGGCAAGCTTCCC
TACACCATCGGCCGGTCCTTCGATGATTACGGGGCAGGCTCCAAACTCATGTACACGCCAAACGGAGTGTTGCCACAGCA
AAAGCTGGACGGAGACATTGACTACCGCTATTTCGACAAAAATAACATCAGCCCACGATTTGAGTTCGGGTTCGGTCTTT
CGTATACGACGTTCGAAGTCGGCAACTTGACTGTGCACGGGCTGAAGCCAAAGAGCCCTCTTCCAGCTCCTCGGCCGTCC
TCGGCCGTGTCGGTACCAGAATACGACAACAGCCTTCCTGACAAAAAGGAAGCCCTTTTCCCATCTGGGTTTCGGAAGCT
GGCAAAGTATGTCTATCCTTACTTGGACTCTGTAGACGACATTGTGGTTCAGCCATACCCATACCCCAAGGGCTACCACG
ATACCCAGCTCCTATCAGGTGCCGGTGGTGACGAGGGTGGAAACCCTGATTTATGGGAAACGTATGTCACGGTCACCGTT
GATGTGCATAACACCGGTCCTCTCTCTGGACAAGCCGTGGTGCAACTGTACCTGGCTTATCCGCAAAACGCTGCCTATGC
TGCCGGTGTTGCATTTCCCGTGAAGGTATTACGCGGCTTTGAAAAAGTGCAGCTTGATGGATCCACAACGCAGTCGGTGG
CCTTCAATTTGACCAGACGTGACCTCAGCTACTGGGATATACATCGACAAAATTGGGCCATGTTGACTGATGGCCAATAT
GGGTTTTTAGTTGGACAAAGCTCTCGGGATCTTCCTCTGAAGGGCAGTTGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62