GenePrediction:GLEAN_4152 Details

Name: GLEAN_4152
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:544731..544474 (- strand)
Length: 258
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:544731..544474 (- strand)
Length: 258
>GLEAN_4152 class=GenePrediction position=GCSC_160:544731..544474 (- strand)
ATGAACGGCCGGCTCTTCACCTTTCTCGAAGAGCAGCTGCGCCGCTACTGGAACGTCTTCTTTCTGCTGGGCAACCACGA
GCCGACCGGGACGAGCTGGCCGGCTGCCAAGGCGACTGTGCGCAGCTTCGTCACGAGGCCGCCGACACGCACGTCATCGC
CAACCAGCGCGGCTATTCTCGGACCCCCGCGGCTGGCTTCGATGCCAAGAAGATTATCTACGTCGGCGAGAGACTGTGCG
CAGATGGGGATGAGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62