GenePrediction:GLEAN_4154 Details

Name: GLEAN_4154
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:538677..537695 (- strand)
Length: 983
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:538677..538619 (- strand)
Length: 59
Type: CDS
Source: GLEAN
Position: GCSC_160:538558..538417 (- strand)
Length: 142
Type: CDS
Source: GLEAN
Position: GCSC_160:538348..537695 (- strand)
Length: 654
>GLEAN_4154 class=GenePrediction position=GCSC_160:538677..537695 (- strand)
ATGGCATCTCCCGTTGGGCGTCTGCAGGGCAAGAATGCCATCGTGACGGGCGCCGCCGGGTGAGTTGTTTCCAGGCGCAT
GGGGGGATTGGGGGCGAATGAGCTGACAGTGGCGCGAAGTGGCATCGGTCTCGAGACCTCGATCCTGTTTGCAAAGGAGG
GCGCAAAGGTGTTGATGGCCGACATCTCGGCGCCGGCGCTGGAAAAGGCGCTGCTGAAGGTCAAGGAGCTCGTTCCTGGG
GCGGCACGGGTCGAGACCACGGTCAGTCCTGTTCTTGTTTTGTCCCGGCTCTGTTCCGGTTCCGGGCGCTGACGCTGACG
GGATGCCAGACTTGTGACGTGTCCAAAGAGGCACAGGTGCAGGCCATGGTCGAGAGCCTGGACAGCTGGGGCGGTGTGGA
CGTGATCTTCAACAACGCGGGCATCATGCACGCCAACGACGACGACGCGGTCAACACGCCGGACGCGATCTGGGACCTGA
CACAGAACATCAACGTCAAGGGTGTCTGGTACGGCAGCAAGCACGCGGTGCTGTCGCTGCGCCGCCACAAGAAGACGCGT
GGTTCCATCATCAACACGGCCTCGGTCGTCGCCCTCGTCGGCTCGGCCACCCCTCAGCTAGCCTACACCGCCAGCAAGGG
TGCCGTGCTGGCCATGACGCGCGAGTTGGCTATCGTCCACGCTCGCGAGGGCTTCCGCTTCAACTCGCTCTGCCCGGCCC
CCCTCAACACTCCGCTGCTGCAGGACTGGCTTGGCGACGACAAGGCTAAGCGCGCCCGCCGTGAGATCCACTTCCCCGTC
GGCCGCTTCGGCGAGGCCGTCGAGCAGGCCCAGGCCGTCGTCTTCCTCGCCTCCGATGAGGCCAGTTTCGTCAACGGCCA
CGACATGGTCGTCGACGGCGGCATGACCAAGGCCTATGTCACCCCCGAGGGCCCCGCCCCGGAGGCACCCCTTAACAACG
CGCTCAAGAACACGCTCAGTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62