GenePrediction:GLEAN_4155 Details

Name: GLEAN_4155
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:537135..535619 (- strand)
Length: 1517
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:537135..536189 (- strand)
Length: 947
Type: CDS
Source: GLEAN
Position: GCSC_160:536114..535619 (- strand)
Length: 496
>GLEAN_4155 class=GenePrediction position=GCSC_160:537135..535619 (- strand)
ATGTCTGCCCGTCGTCCTGCGTCGAGGACGCTCAGCGCGCTCTGTGCCGGAGCCCGTCCTGCAGCACGCCGCCCCAGCAC
GCTGCCGTCCTGTCGGGTTCGCTGCTATTCGGCCTCGACCGAGCCGGACCTCAAGGCCACGCTGCAGGAAGTCATCCCGG
CCAAGCGCGAGCTGCTCAAGAAGATCAAGGCGCAGGGGTCCAAGGTGATTGGCGAGCTCAAGGTGGAGCATACGATCGGT
GGCATGCGTGGACTCAAGGCGATGCTCTGGGAAGCCAGCGTGGTCGATCCGGACGAAGGCATCCGCTTCCACGGCCGCAC
CATCAAGGACTGCCAGCGCGAGCTGCCCAAGGGCCGCACCGGCACCGAGATGCTGCCCGAGTCCATGTTCTGGCTGCTGC
TGACGGGCCGCGTGCCATCGACGGCCCAGGTGCGCGCCCTCTCGCGCGAGCTCGCCGAGAAGGCCGCCCTTCCGACCTTT
GTCAACGAGCTGCTCGACCGTCTGCCGGCCGATGTCCACCCAATGACCCAGTTCGCCATCGCCGTGTCAGCCCTCAGCCA
CACATCCTCGTTTGCCACCGCCTATGCTGCCGGCCTCGCCAAGGCCGACTACTGGGAACCTACCTTTGACGACGCCATCA
GCCTGCTGGCCAAGCTGCCCACCATCGCCGCCAAGATCTACCAGAACGCTTACCACGGCGGCGGCGCCCTGCCGGCCCAG
ATCGACCTCGACCAGGACTGGTCCTACAACTTCGCCGCCATGCTCGGCAAGGGCGGTGAGGAACACGCGAACTTCCAGGA
CCTCCTGCGCCTCTACCTCGCATTGCACGGCGACCACGAGGGCGGCAACGTGTCTGCCCATGCCACCCATCTCGTCGGAA
GCGCCCTTAGCGATCCCTTCCTTAGCTACAGCGCCGGCCTGCAGGGTCTCGCCGGGCCCCTACACGGGTGAGTCTTTTGC
CCCTTCTGCGTCCTCTGCTTCTTGTCTCCTTCCCTCGACACCGTCTGACAGAACCCTACAGCCTCGCCGCCCAGGAGGTT
CTCCGCTGGATCGTCCAGATGAAAGACTCTATTCCCGAAAACTACACGACCGAAGACGTCCGCACATACCTCTGGTCCAC
GCTCAAATCAGGTCGCGTTGTCCCTGGCTACGGCCACGGCGTGCTGCGCAAGCCCGACCCACGATTCGAGGCCCTAATGG
ACTACGCAGCGTCACGTCCGGCCATTTCCGCCGATTCCGTCTTCCGCATCGTCAAGGCCAACAGCGAGATCGCCCCGGCT
GTACTCAAGGAGCACGGCAAGACCAAGAACCCGTACCCCAACGTCGACTCCGCCTCGGGCGTGCTCTTCCACCACTACGG
CTTCCACGAGACACTCTACTACACCGCCACTTTTGGCGTGTCGCGCGGCCTCGGCCCGCTCGCTCAGCTGATCTGGGACC
GCGTTCTTGGCTTGCCAATCGAGCGGCCCAAGAGCATCGACCTCGCCGGCATCCAAAAGCTGATTGAGAACTCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62