GenePrediction:GLEAN_4156 Details

Name: GLEAN_4156
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:532280..528845 (- strand)
Length: 3436
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:532280..529654 (- strand)
Length: 2627
Type: CDS
Source: GLEAN
Position: GCSC_160:529583..528845 (- strand)
Length: 739
>GLEAN_4156 class=GenePrediction position=GCSC_160:532280..528845 (- strand)
ATGCCGCATCCGGTTCTGCCTTCCATGAATAAGTCGCTCCCAATCCTCACCAAAGCCGACGGCGATGGGCCTTCGCAAGC
AGACATCACTGCAACCCTGAACGAGATTTTCACCGCTACCACGTCAAATGCATCCGTCGAGGCTGCGTATCGCCTTTGCG
ATGCCCTCCTGAGCAGCCCGGCTGCCGGCTTTCGTGGCCTCACCAAATACGGTGTCGTTGCCGAACTGAAGAAGGCGGCG
GGTGATAAGAAGAGCGGTCTTCGCCGGGAAAGTGCACAGAACCTTCTCGGTGCCTTGTTCGAGCGTTTTCCTTCTCGCCA
GCCGATCAGCGAGGTCATCTTCCTGATTCAGGATGGCGGCCTAGTTGCTTGTGCGCTTGATGCGCTCGCTGACAAGGGCA
GCGTTGTCCGTGATGCCGCCCAATACGGACTCGATGCTCTGTTCACCCAGCTGCATGCTGAGGCTCTGGTCTCCGGCCTC
CTGCCTGCGCTCATCACCTATCTGCACAAGAAGACGGGCAAGTGGCAGGGCACAGTCGGTGCTCTGAAGCTGATTCAGCG
CATGGCAGACAAAGCCCAGATCGATATCAGTACGACAAAGGCCGAGGCCATCGAGAAGGAGGCCCTGAGAGACATCATGG
GTTCCCGGCTGGCCTCGCTCATCCCCATTGTTGAGGCTGGTATGCACGATCTCAAGACTGAGGTCGAGAAGCAGTCGGTG
CAGACCATGACGTCGGTCACAGCGCTTCTCTCCAACGACGACGTCGCCCCTCGCCTGCCGCTTCTCATTGACACCATGCA
GCACCCGTCGGCCCAGACTCTGCAGAAGGCCATCCATGCTCTTGCTCACACCACGTTTGTCGCCATTGTCACGTCGCCAG
TTCTGGCTCTCCTCACTCCTTTCCTCGAGCGGTCGCTTAACACCCCGACTACGGCCCAGGAGGTGCTGCGCCAGACGGTG
GTCATTGTCGAGAACCTGACGAGACTGGTTCACGACCCCATCGAGGCACGTACGTTCCTTCCCAAGCTTCAGCCTGGCGT
GAAGAGCGTCATGCAGCGCGCTTCGCTCCCGGAAGTGCGTGACCTGGCGACTCGGGCTCTCAACGTCATGGACGTGGCCA
TGACGGCTGACGAAGCTGCTGTTGTGGAGCGGACCACTGCCGATGACGTGGCCAAGGTCCTGGACGCAGAGATTGCCAAG
AAGGGCGGTCTTGCGGCCGACCGTGCCGCATACGACGTTCTTCGCCCGTACATCGGCTCCATGGTGGCAGAGGACGTGAA
CTTCCGTTATGTCACCCGGGTTTCAACTCAGATCGCCCCATACATTGCCCCAGTGCTGAAGGACTCTTCCGCTCACCAGG
CCATTGCCGATGCGGTGCAGGAGTTCTATGTCAGCGAGGATCACCGCAAGTATGGCGAGCCGGAGAAGGATGACGATGGC
GAGACCGAAATTGTCAACGCAGACTTTTCACTGGGCTACGGCGGTATGCTTCTGCTTTCGCACACCAACATGCGCCTCCT
GAAGGGCCATCGGTACGGCCTTGTCGGCCGGAACGGTGCCGGAAAGTCGACTCTCATGAAGAGCATTGCCGGCGGAAAGC
TGGAGGGATTTCCGCCGCAGGACGTGCTTCGGACCTGCTACGTCGAGCACAACCAGGGCGAGGATGCCGAGATTAGCATT
CTCGACTTCGTTTCCAAGGACCCAGAGATTGCGAAAGCAGGCCGGGCGCGCATCATTGAGGTGCTCGACGAGTTTGGTTT
CACATCTGGTCCTGACGGCCGGCAAGCACAGAAGGTCGGCTCTCTGTCTGGTGGATGGAAGATGAAGCTGGCTCTGGCCC
GTGCCATGCTGCAAAAGGCAGACGTCCTCCTGCTGGACGAGCCGACGAATCACCTGGATGTTGCGAACATCAGATGGCTC
GAGAACTACCTCAAGACACACCTGGACGTGACCAGCCTGATCGTTTCTCACGACTCTGGCTTCCTGGACGAGGTCACCAC
GGACATCTACCACTACGAGCCTGGCAAGAAGCTGGCCCACTATAAGGGCAACCTTGCCACCTTTGTCAGCCACCACCCCG
AGGCGAAGAGCTACTACACCCTGACGGCCAGTCAGGTGCAGTTCAAGTTCCCACCGCCCGGTCTTCTGTCCGGTATCAAG
TCGCAGACTCGGGCTATCATCCGTATGACCAACGTGTCGTATGCGTACCCCGGCGCCACAAAGCCGCAGCTGTCGGATGT
GTCTTGCCAGCTGAGCTTGTCGTCGCGGGTGGCGATCATTGGTCCCAACGGTGCCGGAAAGTCTACCCTCATCAAGCTGC
TTACTGGCGAGACGATTCCGTCGACTGGAAAGGTTGAGAAGCACCCCAACTTGCGTATCGGCTACATCAAGCAACACGCT
CTGGAGCACGTCGAAATGCACCTGGAGAAGACCCCCAACCAGTACCTCCAGTGGCGTTACGCACACGGTGATGACCGGGA
GGTGCACATGAAGCAGACGCGTATCGTGTCCGAGATGGACCGTCTGCAGATGGAGAAGTTCATCGAGCCGGCCGCAGGCA
TGGGCCAACGGCAGATTGAGACTCTCGTGGGTCGGCAGAAGTACAAGAAGACGTTCCAATACGAAGTGTGAGTACAGCCC
AACGGCGTCAATCCAACAACACCCGCAAAGCACTCCCATACTGACTGGCAACTTTAGGAAATGGAAGAACATGCTGCCCA
AGCACAACACGCAAGTGACGCGTGAGAAGCTGCTCGAGTGGGGCTACGACAAGCTGATCCAGGAGTTTGACGATCATGAG
TCGTCACGCGAGGGCCTGAGCTTCCGTGAGCTGCAGCCGGCGACCATCTCGAAGCATTTCGAGGATCTCGGCCTCGACCC
CGAGATTGCCAACCACAACGAGATCGGCTCTCTGTCTGGTGGACAGAAGGTGAAGGTCGTCATTGCCGGAGCGATGTGGA
ACAACCCGCATTTGCTGGTGCTGGACGAGCCGACGAATTTCTTGGACCGTGACTCGCTCGGCGGTCTGGCAGTGGCCATC
CGCGACTTCAAGGGCGGTGTCGTCATGATCTCTCACAACGAAGAGTTTGTCGGTGCACTGTCGTCGGAGCAGTGGCACGT
GGCAGACGGTCGTGTGACGCACAAGGGTCGTGAGGCCGTGTCGACGGACCGGTTTGAGGACAGCCGCCCGGGCAGCGGGC
TCACAACGCCGGGTGTGGCCACGCCGGCGATGTCGAGCGCCATCTCGAGCGCAGTCAACAGCGGCCTGGAGGACAACGCG
GTGGGAGACCTCAAGTTCAAGGCGAAGAAGAAGCGCAAGAAGACCAAGAAGGACATGAAGGAGCAGGAGAACCGGCGGCG
CCAGCGGGAGATTGTCTGGTTGAACTCGCCCAAGGGCACGCCGAAGCCGCTCGATACGGACGACGAGGAAGATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62