GenePrediction:GLEAN_4157 Details

Name: GLEAN_4157
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:516033..514322 (- strand)
Length: 1712
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:516033..515950 (- strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_160:515882..515826 (- strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_160:515739..515020 (- strand)
Length: 720
Type: CDS
Source: GLEAN
Position: GCSC_160:514942..514322 (- strand)
Length: 621
>GLEAN_4157 class=GenePrediction position=GCSC_160:516033..514322 (- strand)
ATGTCGGAAGCTGCGTTGAAGCCGGAGAAGGACTTCTCCAAGGAAGCCGCCAAGCAGATTGCTGAGTGCACGGAGCTTGC
AAAGGTTCGTAATGCCGGCCACAGCCTACTTGGGACCTGCGCATGATGTTTGCTAATGCGCCATCTGACAGACCGACATC
CACGCTGCGGTTGAAAAACTGGGCCTGCTGGAGAAACAGACTCGCCAGGTAAGCATACGAGTTGCCTGCGAGTGCCTTAC
TTTGAGTCTGCATCGAGGGCTGGCGGCGAGCTGACGACGGCGAAACGACGATAGGCATCGGATCTGGCTTCTACGGCAAA
CATATTGGTTGCCATCGTTACGATTTGCAAGGATGCCGGCGACTGGAGCTTTCTCAACGACCAGGTCCTGATTCTGTCGA
AGAAGCATGGCCAGCTCAAGCAGGCCATCACACGGATGGTGCAGACCGTGATGGGCTTTCTCGAAGATACACCAAACCCG
GCCACGAAGCTGTCTGTGATCGAGATACTGCGGACGGTGACGGAGGGAAAGATCTTTGTGGAAGTTGAGCGCGCTCGCGT
GACCAAGATCTTGTCGGACATCAAGAAGAAGCAGGGCGACTTGAAAGCGGCAACAGACGTGCTGTGTGAGCTGCAGGTCG
AGACGTTTGGGTCGATGAGCCGCAGAGAGAAGACAGAGTTTATTTTGGCGCAAGTCGGTCTGTGCATCGAAATTGAAGAC
TGGACGCAAGCGGCAATCCTCAGTCGGAAGATCAGCACAAAGTACTTGTCCAGGAAACCGAAGAAGACGGCCGAACAGCT
GGAAAAAGAGAAGAAGGAGCGAGAGAAGAAGATCGAGCGGGGCGACGAGGTGGAGGAGGAGAAGGAAGATGATGTGACAG
ACCTGAAGCTGCGTTACTACGAGCAGCAGGTCATCCTGGCCAAGCACGAGGACAAGTACCTCGATGTCTGCAAGCACTTC
AGACAGGTTTTGGACACGGAGGCGGTTGAGACGGACCCCGCAAAGCTCCACGCGGTATGCTGCCCCTCTTTCCAGGCTAT
GGTCCTGGACGTTTACAAAACGAGTTGGTTGCTGACTATTCTTGTCATTAGGTATTGCAACGCATCATTTACTTTGTCAT
TCTCGCCCCGTACGACAACGAGCAAAACGACCTGCTGGAGAGAATCGCCAGGGATGCGCGAAACAGCCAGATCCCAAAGG
ACGCCGAACTGCTCAAGTTGTTTACGGTACAGGAGCTGATGCGGTGGCCGGAGGTGGCCAAGGTGTTTGGACCGTATCTT
ACGGAGACGGACGTGTTCGATGCAGCCGAGGGCGACTCAGACGACTCGAAGGCGTTCAAGCGCTGGCAGGATCTGCGCAA
GCGGGTCATTGAGCACAACGTCCGCGTGGTGTCCAAGTACTACACGCGCATACGGATGGGCCGGCTGACCCAGCTGCTGG
ACCTGACGGAGGACGAGACGGAGAAGTACATCAGCGACCTGGTGACGTCCAAGACGATCTACGCCAAGATCGATCGGCCG
GCTCGCATTGTGAGCTTTGCCAAGCCAAGAGATGCAGACGACATCCTTAATGACTGGAGCTACGACATGAAGAGCCTGCT
GGGTCTGTTGGAGAGAATCGACCACCTCATCACTAAGGAAGAGATGATGGCGCGTATCCAGACAGGGGCATCTGGGAAGG
CAGAGAAGAAAAAGGCGGCTGTGGTGAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62