GenePrediction:GLEAN_4158 Details

Name: GLEAN_4158
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:511770..510614 (- strand)
Length: 1157
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:511770..511164 (- strand)
Length: 607
Type: CDS
Source: GLEAN
Position: GCSC_160:511098..510614 (- strand)
Length: 485
>GLEAN_4158 class=GenePrediction position=GCSC_160:511770..510614 (- strand)
ATGTTTACGACGAAGCCTTTTCTTCGGGCCACGGCCTGTTCCGTGCCGTTTCGCAGTGTGCGGGCGTTTGGCAGCACGGG
CATAGTCCTTGACAAGAAGCTAGTGCCAGTTCCATCTCTGGCAGACATCGAGCCTGAGAACACGGCTCAGTTTAACAGCA
AGCAAAGGGCCTTCCGAGAGCATCTTATGCAGGCTCAGAAGGCCAGCGATGCGAGTGCGTTGTCCTCTGCATCTTCTTCT
GCTACGGAGACAAACGGTTCTGCCGCTTCTGCAAAGGGCTTAGGCTCACTGAGTACTGCTAAAGGAAGCGCCACCGGGGC
CTCTGACACGGCCTCCGGCCGCAAACAGGGCCCAATCTCCAACTTGATCTACGGCACCAAAGAGGGACGCGAGCTTGACG
CGCAGATTGAGGCTAGCTTCAGTCAGCTACTGGCGCGAGGAAAGTATATGCACTCCATCATACTCCATTTCCTGGTGAAG
CCAGACAAGGTGGAAGAGTATGTGCAATTGATCGGAAAGTGGTATCCCAAGATCGCCAGCATACCAGAAAATAAGGTGCA
TCTGGTTGGAAGCTGGCGCACTGAAGTTGGCGATTGCGACACGTTTGGTAAGCCGCCTTTCCCTTAGTCTAAATAAGCAC
GCTCGTATGTTTGCAACATCTGACCGGTTCAGTACACGTCTGGGAATACCAGAAATACGAGGGCTACCATTCGTCGATCA
AGTCGGTGTCTCGCCATCCTGACTTCCCCGAATTCGACCGTACACTCAGGACGCTCATCAACTCGGAGAAGACCTCTCTG
ATGCAGGAATTTTCCTTCTGGCCCACGACGCCGCCGCGACAGCTGGGCGGTATCTTTGAGCTTCGATCCTACACGCTCCA
CCCGGGCAACCTGTTGGAGTGGGAGACGCACTGGCGGCGTGGACTCACGGCCAGGCGGGAAGTCATGGAGGGCGTGGGAG
CTTGGTTTGTCCAGATCGGGGAGCTCAATACCGTCCATCATCTCTGGCAGTTTGCCAATCTAGAAGAGCGCAAGAAGCGA
CGGGAGCAAAGCTGGGAAATTGAGGGATGGAGCAATACGGTGCACAAGACCGTGCCTCTTATACAGTCGATGAAGTCACG
CATCTTGGTCCCAATGCCCTGGTCGCCCGTGTCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62