GenePrediction:GLEAN_4159 Details

Name: GLEAN_4159
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:508737..508002 (- strand)
Length: 736
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:508737..508671 (- strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_160:508588..508002 (- strand)
Length: 587
>GLEAN_4159 class=GenePrediction position=GCSC_160:508737..508002 (- strand)
ATGGGGGAGAAAGTCGCTCCGATGGTAGCTGAGAATCAGCAAAAGAAGATGGGCCACCTGCAACCTGGTGCGTGTCTCTC
ACCTGGCCTCAGAGGCGGCGGCTCTGATGTGTCACTGGCTCGTGAAATTGGTTGCTAACTTTTTTGCAGGCGTTATTGCT
CGCCGGAGGCCCATAATTGGGCGTGGCCATCCGGCATCAGCGTTTGGCAAGCCGCTTGGAGTGATTTATGTCTCGCGCCA
GGCGGCCTTCATGTCTCTCGTCAACCGTGCGATCAAGCTGCTGGACGAGGGGCCTGGCGGCGCCAAGTGGTCCGCGACGA
GAGTTTTGCCGCTGAACGAGCGCGCCAAGGCAAACCGACAGGCGATAACAGGCCCGCCTGCTTCGGCGAAACGGTCAGAC
CTGCGGGCGGTGCGCCAGCGCGAGGTCCATCTTCTTGCCACAGGCCATGCGATCAGCAAACTCACCCTAGTGGCGGCCTG
GTTTCAGCGCCAACAGGGTTATGTGGTGGAAGTACGGACGCGCTGGTCAGCCACGGTGGACGATCTCTTAATACCTGTGG
GCGGGGACAGCAGCGACGGCAGTGGCAAGGGAGAGACCGGTGGCTTGGAACACCCACAATCAGACGAACAGGATAGAGAG
CAGGACAAGACGGGCGATACTGCGTCCCAATGGCCAAGACACGAGACCCGGCTGAGAAATGTCAGCTGTCTGGAGGTGGC
CATCCGGCTGGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62