GenePrediction:GLEAN_415 Details

Name: GLEAN_415
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1647972..1648685 (+ strand)
Length: 714
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1647972..1647993 (+ strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_167:1648056..1648208 (+ strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_167:1648280..1648392 (+ strand)
Length: 113
Type: CDS
Source: GLEAN
Position: GCSC_167:1648464..1648581 (+ strand)
Length: 118
Type: CDS
Source: GLEAN
Position: GCSC_167:1648645..1648685 (+ strand)
Length: 41
>GLEAN_415 class=GenePrediction position=GCSC_167:1647972..1648685 (+ strand)
ATGGCTGGCCGACAGGAATCCAGTAAACTTTCACTCTCACCCGTCGTCCTGGTGATTCGAGCTCATTGCTAACCACACCT
CTAGTAAATCTCGACAGTCTCAGCCCACAGCAGCTCAGCGCTGTCAAGAAGCAGCTGGACGATGAGGTTGAGCACTTGAC
CTCATCCTTTTCGCAGCTCGCAGCTGCCCAGGGCAAATTCCGGGAGTGCTTGCGCTGTGTGCAGGGAAAGCCACGGGGTG
CGTTATGTACCTGCAGGCTCTTCACTGTTCAAGTCCCACTGAACCCGGAAAAGCTAATTCGACTATAGAAGCTGGGAAGA
AAGTCCTTGTACCGTTGACAAATTCCCTCTACGTCAGCGGCACGCTGTCTGATCCGAACCGGGTCATTGTCGATGTCGGC
ACTGGATTCTATATTGAAAAGGTTCGAACCGCCTTGGGGTCTTTCAGAAACTGTCGTAACTTGGTTCTATGAACTGACAT
GCAGTTGTACAGGACATCAAGAGCGCTGCACAGTTTTACGAGGACAAGATAACCGAGCTTACTGGGAACATCCAGGAGCT
GGAGATCATCGTCCAGGGTAAAACAAACAACTTAAGAGTTGTAGAAGAAGGTAAGCTACTCAACTTTTATTGTTCTGGTA
CTGTTCCCTGCTTGATTTCTAATAAACGGACAGTTTTACGGCAAAAGGTCCTCGCAAGTCCGCCTGCGGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62