GenePrediction:GLEAN_4160 Details

Name: GLEAN_4160
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:507111..505554 (- strand)
Length: 1558
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:507111..506980 (- strand)
Length: 132
Type: CDS
Source: GLEAN
Position: GCSC_160:506892..506004 (- strand)
Length: 889
Type: CDS
Source: GLEAN
Position: GCSC_160:505942..505889 (- strand)
Length: 54
Type: CDS
Source: GLEAN
Position: GCSC_160:505824..505751 (- strand)
Length: 74
Type: CDS
Source: GLEAN
Position: GCSC_160:505691..505554 (- strand)
Length: 138
>GLEAN_4160 class=GenePrediction position=GCSC_160:507111..505554 (- strand)
ATGGCGCCCAGGAGCTTGGAGACGGCCACGCCGCCGCCATCCGAGCGCTGTCATATCCATGCCCCCGGGCTGGCCTGCCG
ACGGCACCAGCAGCAGGTCAACACGACGACGGGGCAAGCCAGGAAATGTCCGGTCCTTCTGTGCTGGGCTTCTCCAACAT
CGTCCGGCGGGCCCAACGCTCCGCCCAGCAGAAGAGAATATATATCTGCATCTTAACAGCCAGGTGGAAGGCCCAATTCA
ATTTACCATCACATCGCAGACCCAAGAGCCTCGGTTCAGCACCATCTCATCACCACTCCCTTGTTATATATTTCCTCCTA
TCCGCTTCTCCTCTCAGACCAGCTGTTCATCCTGGCCAACTTGATCACATACATCATTCAAGCCATTATTCGTCTCTACC
GCGCAATCTTCCGTCCCAAACGCCAGAAAGAGAGCGTGCTGCCCATCTCGTCCTCAGCCATCTCGACCGAAGCATTCAGC
AACCACTACAACAGCACATCCGCTAAGATGCCTGCCACCACGACCCCGGCCGAGAACGGCAACGGCAGCACCAGCAGCAA
GTACGATGCCATCCCGGGTCCGCTCGGTCTGGGTGCGGCCTCGCTAGCCGGCAAGGTCGCGCTGGTCACGGGTGCCGGCC
GCGGCATCGGCCGTGAGATGGCGCTGGAGCTGGGCCGCCGCGGCGCAAAGGTCGTGGTCAACTACGCCAACAGCGACTCG
TCCGCACAGGAGGTCGTGGCAGCCATCAAGAAGTCGGGGTCCGACGCCGTTGCCGTCAAGGCCAACGTGTCCGACGTCGA
CCAGATCGTCTTCCTCTTCGCCGAGGCCATCAAGGCCTTTGGCAAGCTCAACATTGTCTGCTCTAACTCGGGTGTCGTCA
GCTTCGGCCACGTCAAGGACGTCACCCCCGAGGAGTTTGACCGTGTCTTCAGTGTCAACACCCGCGGCCAGTTCTTCGTT
GCCCGCGAGGCCTACAAGAATCTCGAGGTCGGTGGCCGCCTCATCCTCATGGGCTCCATCACCGGCCAGGCCAAGGCCGT
CCCCAGACACGCCGTCTACTCTGCCAGCAAGGGCGCTATCGAGACCTTTGTCCGCTGCATGGCCATCGGTACGCAGACTG
CCCTCTCTGTCCTCTCCACGTCACATCTGTGCTCCTGCTGACAAGCTAGACTTTGGCGACAAGAAGATCACCGTCAACGC
AGTGGCCCCCGGTGGGATCAAGAGTAAGTCTGACCCCAAGACGGACAGCTCTCTGAAGGCGAAAACCTGCTGACACTCTA
ACTACAGCCGACATGTACCACAAGGTCTGCCGTGAGTACATCCCCGGCGGCCTGGGCTTTACGGATGAGGAGACAGACGA
GGTAAACAGTGCCATTGTTAGAGAAGATTCGCAAGAGGCTTGGCTAACAACATGCTACAGTATGCTGCCGGCTGGTCACC
GATACACCGTGTCGGCCTCCCGATCGATGTAGCTCGTGTTGTGGCCTTCCTGGCCTCCCAAGATGGAGAATGGATCAACG
GAAAGGTCCTTGGCGTGGATGGCGGTGCTTGCATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62