GenePrediction:GLEAN_4161 Details

Name: GLEAN_4161
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:499173..497276 (- strand)
Length: 1898
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:499173..498747 (- strand)
Length: 427
Type: CDS
Source: GLEAN
Position: GCSC_160:498675..497276 (- strand)
Length: 1400
>GLEAN_4161 class=GenePrediction position=GCSC_160:499173..497276 (- strand)
ATGCTGAGACGCCCTGTGCTGTTTGCGGCCGCCCGACGGACGACCTCATCGCTCGTGCCGCGGAATCCAAAGACGTTCAA
TTTCGTTGCTGCACGACTGCTGTCGACAACCATGGCCCGCCGAGGGGCTTCTCTACCTGTGGTGCAGCCACCGCTGACAT
CCACACATGCGGCTGACGCCTTCCAGTTGCTGCCCGAGGCAGAAAAGGCGGGCGCAGCAGAAGACTTGCTGTACGAGCAG
CAGATCAAAGATGTGGAGGCATGGTGGGCAACACCACGCTATGCTGGCATCCGGCGGCCCTATTCGGCCGCAGACGTGGT
CTCCAAGCGCGGTTCGCAGATGCAGACGTATCCCAGTTCTGCAATGGCACGCAAGCTCTGGAATCTCGTCCGCGAACGCG
AAGCCAAGGGCGAGCCCATCCACACGCGTAAGTGCAACCGCGATGATGCATGCTATTGCACATCGAGCCTGCTGACCGTG
CCCTCGTCTCTCTTTCAGTGGGCGCCATCGATCCTGTCCAGATGACACAGCAAGCCCCCCACCAAGAGGTGCTGTACATT
TCCGGCTGGGCCTGCTCGTCGACCCTCACGACGACAAACGAGGTGTCGCCCGACTTTGGCGACTACCCGTATAACACAGT
GCCCAACCAGGTACAGCGCATGGCCAAGGCCCAAAGCATGCATGACCGCAAGCAGTGGGACGCACGGCGGAAGCTGACGG
CGGCGGAGCGAGCCAAGACGCCATACACCGACTACCTGCGGCCGATTGTGGCGGACGGCGATACGGGCCACGGAGGCCTC
TCGGCGGTGCTGAAGCTGGCCAAGCTGTTTGCCGAGAATGGGGCGGCGGCGGTGCACTTTGAGGACCAGCTGCACGGCGG
CAAGAAGTGTGGCCATCTGGCCGGCAAGGTGCTGGTGCCGATGGGTGAACACATCAACCGTCTGGTGGCGGCACGCTTCC
AGTGGGATGTCATGGGCACCGAGAACCTGGTGATAGCCCGGACGGACTCGGAGTCGGGCCGGCTGATCAGCTCGGCCATT
GATGTGCGCGACCACGAGTTCGTCCTCGGTGTGGCGGACCCGTCAGTCCAGCCGTTGGCCGAGACGCTGCAGGCCATGGA
AGCCCGCGGCGCCTCGAGCGAGGAGATCGACATCTTCGAGGCTGAATGGGTCAAGAAGAGCACGCTAGTCACCTTTGACG
AGGCTGCGGTGGCGCACCTGCGGGCCGAGGGCGTGGCCGAAGCGGACGTGGCCTCGTACGAGGCGGCCGTGGCAGCCAAC
CGCGACATGGGCATCTCGGAGCACCGGGCTCTGGCTAACAGCCGCGCGCCGGCCGGCCGCCCAGTCTACTTCAGCTGGGA
CGTGCCGCGCACGCGCGAGGGCTTCTACCACTACCGCGCCGGCATGGCAGCAGCGACCAAGCGGGCCCTCGCCTTTGGCC
CGTACGCAGACCTGCTCTGGGTCGAGACCGGTGACCCGTCCGTGGAGGTGGCGCGCGATCTCGGCCGGCAGGTCCGGGCG
GCGTATCCGGGCAAGGGCCTGGTGTACAACCTCTCGCCGTCGTTCAACTGGATGGCCCACGGCTTCTCCGAGGAGACGCT
GCGCTCGTTCGTCTGGGATATTGCCCGCGAGGGCTTCGTCCTGCAGCTTGTCTCGCTGGCCGGCCTTCACACCACGGCCA
CGGCGACGTGTGCTCTGGCGCGCAGCTTCCGCAGCGATGGCATGCTGGCCTATGTCAACCTGGTGCAGCGCCCCGAGAAG
GAGCTTGGATGCGACGTGCTCACGCACCAGAAGTGGAGTGGCGCCAGCTACATGGACGGCATCATGGGCGCCATCCAGAG
CGGAAGCTCGGGGAGCAAGAGCATGGGCGAGGGCGGCACAGAGTCGCAGTTTGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62