GenePrediction:GLEAN_4162 Details

Name: GLEAN_4162
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:496433..494371 (- strand)
Length: 2063
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:496433..496410 (- strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_160:496291..496126 (- strand)
Length: 166
Type: CDS
Source: GLEAN
Position: GCSC_160:496054..496039 (- strand)
Length: 16
Type: CDS
Source: GLEAN
Position: GCSC_160:495968..495844 (- strand)
Length: 125
Type: CDS
Source: GLEAN
Position: GCSC_160:495769..495712 (- strand)
Length: 58
Type: CDS
Source: GLEAN
Position: GCSC_160:495643..495357 (- strand)
Length: 287
Type: CDS
Source: GLEAN
Position: GCSC_160:495284..495154 (- strand)
Length: 131
Type: CDS
Source: GLEAN
Position: GCSC_160:495092..495082 (- strand)
Length: 11
Type: CDS
Source: GLEAN
Position: GCSC_160:494922..494587 (- strand)
Length: 336
Type: CDS
Source: GLEAN
Position: GCSC_160:494491..494371 (- strand)
Length: 121
>GLEAN_4162 class=GenePrediction position=GCSC_160:496433..494371 (- strand)
ATGTCTCCGTCAGCAGACCCCACGGTTCGTCTCTCCTCTCGAATGGTTACCTTCCGTTCCCGCCTTCTCCAGCGTGCAGC
CGTGGCCAATTGCATGCCTCCCTTCCCCAGAAGCGCTCAATCTAATCGTTTCAATGATACAGAGCGCAAGTTTGCCCAAC
ACCTCAGGCCAGCATCAGCAGCCGTCCACACAAGGCAGCAACCCGTACCAGCCGGTTGGCGACTTTTTGTCCAATGTTTC
CCGCTTCAAGCTCATCGAGTCTACTCTGCGTGAGGGCGAGCAGTTCGCCAACGCCTTTTTCGATACTGGTGAGTCATACT
GCTCCCGGGACAGTGGCCGTCTGGAAGGAGCGATACTAATGTAGCATTCCCGAGTACAGAGACCAAGATCAAGATGTACG
TCCCGTAGCGGACCTCACACCTCTCACTGACTGGCATCGGAATGACTGACACGTGCGACTTGTAGTGCCAAGGCTCTGGA
TGACTTTGGTGTCGACTACATTGAGCTTACCTCTCCCGCTGCTTCTGAGCAGTCTCGCCTGGACTGCGTGGCTATCTGCA
ATCTCGGACTCAAGGCCAAGATTTTGACCCGTACGCTTGACTTTTCCCAGACAGTTGGTGTGACTGGGGGGCTAGGTCGT
TCTGTCTACTAACCGCTTACGCAGACGTCCGGTGCACAATGGAGGATGCTCGCATCGCGGTCGAGACCGGTGTTGACGGC
CTGTAGGACACACCCTCCTCACTCAAACTCCTGACCCCTTGTCTGCTCAAGTCTGACATGATTTTTCCAGTGACGTCGTC
ATCGGCACTTCTCACTTCCTGCGCGAGTTCTCGCACGGCAAGGACATGGCCTACATCACCAAGAGCGCCATTGAGGTCAT
CAACTTCATCAAGTCGAAGGGTCTGGAGGTCCGCTTCTCGTCAGAGGACTCTTTCCGGTCCGATCTCGTCGACCTTCTCT
CCCTCTACCGCACAGTCGACAAGGTTGGCGTCAACCGTGTTGGTATCGCAGACACCGTCGGTTGCGCTACTCCCCGCCAG
GTTTACGACCTTGTACGGACACTTCGTGGTGTTGTCTGTATGTTTTACTCCGCCCACCCCCTCTGTTCTTTTTTTCTTTC
TTGTGCTGCATCGTTTCTGACTCGCACAGCTTGCGATATTGAGTGCCACATGCACAACGATACTGGCTGTGCCATTTCGA
ATGCTTTCTGCGCTCTGGAGGCCGGTGCGACACACGTGGACGTGTCTGTTCTTGGCATTGGTGAGCGGAACGGCATTACA
GTAAGTTTACCATCCCATTGCAGCATCGCACAAGAAAAACATCTGCTAACAGCGTTGATAGCCTCTTGGAGGGTAAGTGA
TAACTGAAAGACCGGGTCCTTCTGTGTTCCAACCCCCGTTAGCACGTCATTTGTCCAAGACGAGTGCCGAGCTGGTAAAA
CGCGGGGTGCTTTGCGTATCAGTCAGTTCGGCGGCGATCTGTGTGACAAGTGCTAACATATCACCATCTAGTTTCCTGGC
GCGCATGATCGTGTCGGACCGTGAGTACGTTACCAAGAAGTACAACCTTCACAAGCTCAAGGAGCTGGAGGATATGGTTG
CCGAGGCTGTGCAGGTCAACACGCCGTTCAATAACTACATCACCGGGTTCTGTGCCTTCACGCACAAGGCTGGCATCCAC
GCCAAGGCGATCCTGAACAACCCCAGCACCTACGAGATCATCGACCCTGCCGACTTCGGCATGACCCGCTACGTGCACTT
TGCTTCGCGTCTGACGGGCTGGAACGCGGTGAAGACTCGTGTGGGCCAGCTGGGTCTGACCATGACTGACGAACAAGTCA
AGCTTGTGTACGTTGTGCCTGCACCACGCACCCTCGTTGGCGTCCCTATGTTCCACATAATTGGCTTCTGGAGGCTAACT
TACAATTTAATACTTTGTACAGCACGAGCAAGATCAAGGACCTCGCAGACGTTCGGCCCATTGCCATCGACGATGCGGAC
TCGATCATCCGGAGCTTCCACCTCGGTCTCGAGGCCAAGACCGCCCCCGCACCAGCGAACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62