GenePrediction:GLEAN_4164 Details

Name: GLEAN_4164
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:491850..490848 (- strand)
Length: 1003
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:491850..491279 (- strand)
Length: 572
Type: CDS
Source: GLEAN
Position: GCSC_160:491205..490848 (- strand)
Length: 358
>GLEAN_4164 class=GenePrediction position=GCSC_160:491850..490848 (- strand)
ATGGCTCAAGGCAGCTCATTCGCCCAGCGGCTGCCGCAGACGGTCAAGAACCACTTCGTTGCTGGTATGGCCGAGTTTGT
CGGCACCTTTCTTTTCCTCTTCTTCGCCCTCGGTGGCACCAATGCCGTCAACTCGGCTGGTTCCCAGGAAAAGACGTTTG
TTCTTGCATCCGACCCCGCCGAGCTTCTGTACATCTGCATCTGCTTCGGCTTCTCTTTGGCTGTTACTGTCTGGCTGTTC
TTCCGTGTCTCTGGCGGCCAGTTTAACCCTGCTGTCACCCTGAGCCTGGTCCTGGTCGGTGCCGTTGGCCCCGTCCGTGG
CTTCGTCGTCTTTATCGCTCAGCTCCTCGGAGGAATGTCTGCTGCCGGCGTGCTGTCCGCTCTCTTCCCCGGCGCGCTCC
AGGCCAGCACCACGCTGCGCTCCGACACCAGCATTGCACGGGGCCTCTTCATTGAGGTCTTTGCTACCTCCATTCTCGTC
CTGGCCGTCCTCATGATGGCTGTTGAGAAGCACCGGGCCACGAGCTGTGCTCCTCTGGTCATTGGTCTGGCTCTCTTTAT
TGCCGAGCTTGTGTAAGTTGCTGTCCCCTTACCCGCTTCCCATGGTTGTATATGCGAACAACTGCTTATCAGCATCGTGC
TACAGGAGCATTCCATACACCGGCGGCAGCGTCAACCCTGCCCGTTCGCTTGGCCCTTGCGTTGCTACGCGCAACTTCAC
CCACTACCACTGGATCTACTGGATCGGTCCGTTTCTGGGTGGTCTTCTCGCCACGCTTTACTACAAGATCATCAAGGTTC
TTGAGTACGAGACTGTCAACCCGGGCCAGGATGATGACGGTCTTCCTCGCTACATGCCCAAGGAGCACAACAACGGCCTG
TTCCACCCCGAGGAGAAGCGTAACGGCACTGCTGAGCGCAAGCTGAGCGGCGACACTCGTTTCGGTGAGGGTTTCCGGAC
TGCCCCCGGTCTGGAGGCAGGTCAGAACGTTGCCAACGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62