GenePrediction:GLEAN_4165 Details

Name: GLEAN_4165
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:489099..488167 (- strand)
Length: 933
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:489099..488898 (- strand)
Length: 202
Type: CDS
Source: GLEAN
Position: GCSC_160:488798..488167 (- strand)
Length: 632
>GLEAN_4165 class=GenePrediction position=GCSC_160:489099..488167 (- strand)
ATGGCCGACGGAGCAACGGACGAGCTGCCGCCGCCGGCAGCATCACAAAAACCGGCGCTGAAAGGAAGCTGGACACAGGC
CCTGCGCGACGATGTGGATGTGTCTTTTACCTACTTCCACCTGCTCGCGTGCTGCATCATCTCTGGGCTATCGGATAGCG
TGGCGTTCAATGCGGCTGGTGTCTTTGTCAGCATGCAAACCGGTAAGGCTATGTGGTCGGCAATACATTGTCATCGCGAC
GTTTCCGAACGCGTCTAGTGTGTATCTGGACTCACCGTGTTTTTTTTCTCCCGCCTACCAGGAAACACCATCTTCTTGGC
CTTGGGCGCGTCCCACCTTCCGGCTGGCCAGTCCAAGCTCTGGCTGAAGGCCATCGTGTCGATCGCCTTCTTCCAGGCCG
GCTGCTTCTGCTTTTCCAAGTTCCGCTACTTTGGCGCCCAGCGCAAGGCAGTCATGTTCGCGTCGACCTTTCTGCAGACC
GTCTTCGTGGTCGTGGCCGCGGCCCTGGCGCAGTCCAAGGTCGTCGCGGCCTTTGGTGACACGCGGCTGAGCACCGTCTC
GACAAACCCGACCCGGCAGAAGCAGGAGGACGACATGATCATCCTGGTGCCGATCGCCCTGCTCGCCTTCCAGTTTGGCG
GCCAGATCGTCATGAGCCGGGTCTTGGGCTTCAACGAGATTCCAACAAACGTCCTGACGTCGCTCTACTGCGATCTGCTC
TCGGACCCGAAGCTGTTTACAGCCGTCGGGGCTAATGGGAAGCGCAACCGCCGCGTCTCAGCCGCCGTGTTGACACTGTG
TGGCGGCATCATCGGCGGCTGGCTGCAGCGGAGTCGAGGAGGCATGAGCTCGGCGCTGTGGGTCGGCGCGTTTATCAAGC
TCTGCCTCGCACTCTCTTGGCTGGTCTGGCCCAGCAAGAAGAATTTCAAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62