GenePrediction:GLEAN_4166 Details

Name: GLEAN_4166
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:478839..477248 (- strand)
Length: 1592
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:478839..478566 (- strand)
Length: 274
Type: CDS
Source: GLEAN
Position: GCSC_160:478505..478425 (- strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_160:478363..477546 (- strand)
Length: 818
Type: CDS
Source: GLEAN
Position: GCSC_160:477475..477352 (- strand)
Length: 124
Type: CDS
Source: GLEAN
Position: GCSC_160:477294..477248 (- strand)
Length: 47
>GLEAN_4166 class=GenePrediction position=GCSC_160:478839..477248 (- strand)
ATGCATTCCAACTTGGTTGCCCTCTCTACCTTTGCCGCTCTGGCAGCTGGACAGCAGGTAGGGACTCAACAGACCGAGAC
GCACCCTACGATGACATGGAAGAAATGCACGAGCGCGGGCCAATGCGCTGCAGTCAACGGCGAAGTCGTGGTCGATGCCA
ATTGGCGCTGGCTGCATAAAACCGGCAGCTCGACCAACTGCTATACCGGGAACACATGGGACAAGTCGATTTGTCCGGAT
TCTAAGACTTGCACAAGCAACTGTGCAGTTGATGGTAAGATACCGGGACTCTAAATCTTTGTCTCTTATATGTTGGTCCT
AACGCTCTTTGTAGGTGCCAATTACGAGTCTACGTACGGGATTACGACGAACTCGGATGCTTTGTCAATCAGCTTTCTCA
CAAAGGGACAGTATGGTACGTTACCAATTCTTACAACCACCAAAGGGTAAGAAAATGAGGCTGACAATCGTCGCAGCCAC
CAACATTGGCGCTCGCCTCTACTTGATGGCCAGTGAGACCAAGTACCAGATGTTTACCCTGCTGGGTAATGAGTTCACCT
TTGACGTGGACGCGTCAAAGCTGGGCTGTGGTCTGAACGGTGCTCTCTATTTCGTGTCCATGGATGAGGACGGTGGCATG
AGCAAGTACCCGGATAACAAGGCCGGTGCCAAGTATGGCACAGGCTACTGCGACTCGCAGTGCCCGCGTGATCTCAAGTT
CATCAACGGCGTGGCCAATTCGGATAACTGGACGGCATCGACTACTGACTCCAACTCGGGTGTTGGCGGCTACGGCTCGT
GCTGCTCGGAGATGGACATCTGGGAGGCCAACTCCATGTCGACAGCCTACACGGCGCACCCGTGCAAGACCGTCGGCCAG
GTGCGCTGCGAGGGCGACAACTGTGGCGGCACATACTCGTCCTCGCGGTATGCCGGAACGTGCGATCCGGACGGTTGTGA
TTTCAACTCGTACCGCCAGGGCAACACCAAGTTCTATGGGCCCGGCATGACCGTAGACACGAAGTCGGTGGTGACAGTGG
TGACGCAGTTCATCAAAGACAGCAGCAACGGCCTGTCGGCGATCCGGCGCTTCTACGTGCAGAACGGCAAGGTGATTCCC
AACTCGGTGTCGACCCTCAAGGGCGCGGGAGGCAACGAGATCAACGCGAAATTCTGCAAGGCCCAGAAGGCTGCCTTTGG
CGACAAGGACATATTCAACGCAAAGGGCGGCATGGCCCAGATGGGCGCTGCAGTTGCAAAGCCCATGGTTCTGGTCATGT
CTCTTTGGGACGATGTAAGTTGGGGGGAAAGAAGAAAGAAAGAAAAGGGATAAAACGAAAAAGGTCCAAACTAACACTAT
ATAGCACTACTCCGACATGCTTTGGCTCGAATCGACCTACGCAGGAACCGCTCGTGGCTCATGCAGCACCTCCTCTGGCG
TGCCTGCCACCGTTGAGTCTGAGCAGGCCAGTGCCAAGGTCATCTTCTGTAAGTTTGAGTCTTTCCGCTTCGGCCATCCA
TATGCTAACGATTATACCGCTCCAGCCAACATCAAGTTTGGCCCCATCAACTCGACCTTCACGTCCAGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62