GenePrediction:GLEAN_416 Details

Name: GLEAN_416
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1651470..1653936 (+ strand)
Length: 2467
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1651470..1651877 (+ strand)
Length: 408
Type: CDS
Source: GLEAN
Position: GCSC_167:1651953..1653051 (+ strand)
Length: 1099
Type: CDS
Source: GLEAN
Position: GCSC_167:1653134..1653936 (+ strand)
Length: 803
>GLEAN_416 class=GenePrediction position=GCSC_167:1651470..1653936 (+ strand)
ATGCCTCTCCTCAAGCCATCAAAAAAACTGTCCAGAAAGCCGAGGACACGCAAGATAGTGCCTGGGATTTTGCGCGAAGA
TTCAGACGACGAACTTGGCGACAGTGACCTTCCATGGGAGTGGATATACGAAAATGCAAGCACTACGGCAGAGCCAAACG
GGCGAGAAGCGTCTCAGAAGCGGAAACGATCAGAGAAGTCCAGCAGGATTATCGGCGCACGGATGGGCGAGTTCGAGTGC
AGACACGGAGACACTGTGTTGCTGAAAGCTGAGGGCTCCAACGAAGCATGGGTCGGTTTGATATGTGACTTCCTCGAAGA
GGATGACCAGAAAAAGGCACATTTCATGTGGTTCTCGACCGAGAGGGAGATCCGCAACAAGATAAAGAAGAGGACCGACT
TTTTGCCTGTAAGCGGACGGATGGCGAGCGAAGGAACAGGATGGTATAATTAGTGGGAAGGCGTGCTGACATGGAGGTTG
CAGAACGAGTTATACATCTCGCCGTCGTGGGATTATAACCCCTTAGCATCGATCAACGGACGAGCGCAGATAATGTCCCT
CGCGACTTTCTACCAGAAGTACCCAAACGGCCGCGTGCCGCGAAACGCAAAGGAAAACGGCAAGGTGTTTGTATGTCGGC
GCGGTTGTAACACGCGGACAGCAAGCTACACGGAAGAGTTTGTGTGGGAAGACCTGTTCTCGGGCTCGGCAGAAGACATT
GAGAATCTAGTTGAGATGATCAAGACGGGAACAAAGGCGACACGGAAGAAGCGACAGACAGCCAAGGACGAGGATGCGGA
GGATCCATACGTATTTGCTGGAGACGACGAGGGCGCAGAGGAGCGGGAGTTCCAGACACCCAAGAAGAAGACCAAGACAT
TTGAGGCTACGACGCCGACGAGCAAGGCACCACGCAGCGCGTCCAAGTTTATGACGCCATCGCATCGGCGGGTGATGGTC
AAGAAACAGCTGGAGTTTACGCCGCTGGCGACACGCACACTATCACCGGGCCACTTCCAGGCATCGCCTTTCCAGCGGGC
GCGGGCGCAGCTGCACGTGGCCTCGGTGCCAACGAGCCTGCCATGCCGAGAGAGCGAGTTTTCGCTGGTGTACTCACACC
TGGAAGCGGCAATCACCGAGGGCACGGGGTCGTGCATCTACATCTCGGGCACGCCCGGCACAGGCAAGACGGCGACGGTG
CGGGAAGTAGTGGCACAGCTGGACTGCGCGGTGCAGTCGGACGAGCTGGACGACTTCATCTTTGTGGAGATCAACGGAAT
GAAGATCACGGACCCGCATCAGTCGTACTCGCTGCTATGGGAGGCGCTCAAGGGGCAGCGGGTCAGCCCGGGCCAGGCTC
TGGATCTGCTGGAGCACGAGTTCAGCAATCCGAGCCCGCGACGGGTGCCATGTGTGGTGCTGATGGACGAGCTGGACCAG
CTGGTGACCAAGAACCAGGGCGTGATGTACAACTTTTTCAACTGGCCCAGCTTGCGGCACAGCCGGCTGATTGTGCTGGC
GGTGGCGAACACGATGGATCTTCCAGAGCGGACGCTGAGCAACAAGATCAGTAGTCGATTGGGTAAATAGTGGCTCGGCC
TGCCATGGCGTTTTTGCCTTTTTTGCCTTTTTGGCGTCTCTCCTGCATGCTAACTTTGTTGCAGGATTGACTCGCATTAC
GTTCCCGGGCTATAACCACGAGCAGCTGATGAAGATCATCCAGTCGCGCCTAGAGGGTGTGCCGGGTAGCATGGTGGACC
CGGACGCGATCCAGTTTGCGAGTCGGAAGGTAGCGGCTGTCAGCGGTGATGCGCGACGTGCTCTGGATATTTGCCGGCGG
GCGGTGGAGCTGGCGGAGGCGGAGAGCCGTCAGGCGCCGGTGCCAGGGACGCCGACGAAGCCGAAGAGGGGCGAGACCTC
GTTGACGGTGGCGGCAACATCCAGCAAGCGGAGCAATAGCAGCGGCCGGGTGACCATCGACACGGTGCGGCGGGCCATTG
CGGAGGCGACGTCGAGCCCGCTGCAGCAGTACCTGCGGGCGCTTCCATTTGCGTCGCGGCTGCTGCTGGCAGCTTTGGTG
GCGCGGGCACAGAGGACCGGCCTGGCCGAGAGCACGTATGGCGACGTGCTCGAGGAGACGGAACGGTCGCTGCGGATGGC
GATGGCGATGGCGGCCGGCACAGCCGAGGGTCGGCCGCTCGAGGTGCTCGGCGGTGCGGACGCAAAGGCGGGTGCTGACG
GATCGCGCAAGCACACAGGCGGAGCAGCAGCTGCGGCAGCCTCGCGGGGGGTCCGGCTGGCCGGGCTTGGAGGCGCGGCG
GCTGATCTGGCCGGGGCGGGCATCCTGTATCTGGAAGGGCAGCGGGTGGAGCGGCCGAGCAAGATGCGGCTGGCCGTGGG
CGATGAGGACGTGCGGTTGGCCTTTCGCGACGATCCGGAGATCAAGGCGACGGGGTTGGTGGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62