GenePrediction:GLEAN_4170 Details

Name: GLEAN_4170
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:450241..449207 (- strand)
Length: 1035
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:450241..450143 (- strand)
Length: 99
Type: CDS
Source: GLEAN
Position: GCSC_160:450077..449793 (- strand)
Length: 285
Type: CDS
Source: GLEAN
Position: GCSC_160:449722..449207 (- strand)
Length: 516
>GLEAN_4170 class=GenePrediction position=GCSC_160:450241..449207 (- strand)
ATGGAGAACTCTCGCGCCCAGTACAACAGCCGGAAGGGTGTCAGTCTAGGCAACATCATCGGCGACCCCTTTGCGCTGGC
CACCATTTCCATCTCAACCGTGAGCACAACCAGCCTGGATCTGACCTCCTCTTGTCGTCTTGCTAACCGCCGTGTTCGTT
CTAGCTGGCATGGATCATCTCTTTCATTTCCTCTATCATTGCGCAAATCCAAACATCAAATGACTTCAAGACCTTCACGT
GGTGGGCCGTCGTCTTCTATTTCTTCCTCATTCCCGGTATCTTCGTTGTCGTCGCTTCGGATACGACGCAGACGTACAGT
GTGGCCATCGTTGGCTATCTGGCTTGCGGCCTAGTCCTGGCCACGTCCTCCGTCAACAACTTGGTGTACTCTTCGAACGG
TGCCAGCGAGGCCGCTGCCGCTGGCTTCATTCTCTTATCGATGGTTACGGTGCGCTACGATTTTTCTCAATCGCTGGTCT
AAACGCTTGCGTTCCTCTGCTAATTCTCGTCCTTCACAGATTGTCTGGATCTTCTACTTTGGCTCAGCGCCGTCCGCCGT
TCCACGCGCCTACCTCGACTCCTTCTCCTTGGCTAAGGAGTCGACCATGAACAGACAAGTCATGACCGGCGCCTACGGCA
TTAATGGTCGTCCCGAGACATCCACCTCCGTCCAGCCCCCTCAGATGTACACGTCCGCCCAGCTTAATGGCTTCGAGAAC
CCATCACCTGTCGCTGGAATCTCAAGTGGCGGCAACCGGAACTCGGCTCTCAATGGTGGAGCATTTGCATCACAAGCCAA
GACCAATTCTGTTGCTCTGGGCGGTACAGACGGAGAGATAGTACCTCCCACGGAGTACCCATACCGGGCAAAGGCCATCT
ACAGCTACGAGGCGAACCCCGAGGACGCAAACGAGATCAGCTTTTCCAAGCACGAGATTCTCGAAGTCTCTGATGTCAGC
GGAAGATGGTGGCAAGCTCGCAAGGAGACTGGTGAGACGGGTATCGCGCCAAGCAACTATCTCATCTTGTTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62