GenePrediction:GLEAN_4171 Details

Name: GLEAN_4171
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:445215..444031 (- strand)
Length: 1185
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:445215..445149 (- strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_160:444954..444860 (- strand)
Length: 95
Type: CDS
Source: GLEAN
Position: GCSC_160:444619..444523 (- strand)
Length: 97
Type: CDS
Source: GLEAN
Position: GCSC_160:444465..444237 (- strand)
Length: 229
Type: CDS
Source: GLEAN
Position: GCSC_160:444133..444031 (- strand)
Length: 103
>GLEAN_4171 class=GenePrediction position=GCSC_160:445215..444031 (- strand)
ATGTCCAGTGGTGCCTTTTCTATTGATCAGCTCATGGAACTGGCCGGGCTGTCTGTCTCGCAAGCTGGTGCGTGCTCGCT
GTATCTGCTTCTGCCTGGTGCTGGCTTATAGACTCATGTGATGAGCTTCTTAGTGTATCGCGTCCACCCTCTCAGCAAAG
GCCGCCGGATTTTGGTGGCCTGTGGCCCTGGCAACAACGGTGAGCTTGCTGGACCGCCCAGCCCTTCGGCCATACTCTGA
CATGGAGCTAATCAAGACCAGGCGGAGACGGACTCGTTGCTGCCAGACACCTGAGACATTATGGCTATGAGCCTTCCGTC
TTCTACCCCAAGCGTAGTAAAACCGATCTGTATCAGGTAAGATACATCCTGGTTCCTTGTCCTCTTTCCTCGACCCGTAC
CTCCTCGTCCTCGTTCGTGTGCATTTACGTTTATTCACGCTGCCCAATGCTGCCAAAACTTGTATAAGAAAGTGAAAATT
GCGACCCAATGCAACCCCCTAATGCAAAGCTTTCCATTATACGATGCTTTCGCCGTCAGCATGCCTCTATGTTATCCCCT
GATGCACAGTATCCCCAAATGCTCATGTTTTCGTAGCGCCTGTCCAAACAGCTGGAGGACTTGGATGTTCTGTTCGTCGA
TGACTTCCCGACGGCCCTCGGATCGGCCGATCATGTCGTGGATGCTATATTTGGTTCGGACGTCCTCTCCCCGTTGTCGT
CGAGTCGCTGATAGCTAATCTCCCGCATAGGTTTCAGCTTCTCGGGTGAGGTGCGGGAACCATTCCGGGCCGTTATTAAA
GCCCTCGAGGAGACCGACCTCCCTGTGACATCGGTAGATGCTCCGTCATCGTGGGATATTGAAACCGGTCCGCCAACATC
CGGTGTCGGGTGCAACTTTCATCCAGCTGTTCTTGTCAGCCTCACAGCTCCCAAGCCACTTTTGAACCATTTCAGGGGTC
GCCATTTTATTGGAGGAAGGTATGCCAAGACTCGCCTCATTCTCTCCAACACCGCCAGCTTGTCTTCCATCCACTGCGCG
TCGCTTTATAATAGCATACCTCTGCTCACAGCATGGTCCCAGATTTGTCGCTCCGTCAATCGCGCAAAAGTATGATTTCG
ATGTGCCGGAATATTCAGGGCTCGATCAGGTGGTAGAGGTGGGAAGCACTGAGGTGAAGCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62