GenePrediction:GLEAN_4174 Details

Name: GLEAN_4174
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:429781..428984 (- strand)
Length: 798
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:429781..429762 (- strand)
Length: 20
Type: CDS
Source: GLEAN
Position: GCSC_160:429636..429409 (- strand)
Length: 228
Type: CDS
Source: GLEAN
Position: GCSC_160:429331..429199 (- strand)
Length: 133
Type: CDS
Source: GLEAN
Position: GCSC_160:429136..428984 (- strand)
Length: 153
>GLEAN_4174 class=GenePrediction position=GCSC_160:429781..428984 (- strand)
ATGTCGACCCGCAAGCCCTTGTATGTCCCTTTGCTCCGCGGAAAGCCGGGATCGCTTCCTTCTGCCCAAACCGAGGGAGA
GAGGGCTGTCCCGGCGGGCCTCGAAGTCAGAGCCGATCCACTGATGCGTGACTTCCGATTTGTAGGTTCAGCCAGCAGCT
TCTGCTCGACACCACCCCGCTGCCCGAATCGATCCCTAAGGTCAAGGAGATTGGAGCGAGCTCAGGCCCCCTCCTCTCGG
CATCCTTCTTCATTGGCGCCCGCTGCCGGCCATACAATGACGACTACATGCAGTGCAAGGCTGAGAACCCCGGCAATGGC
GAGGTCGAGTGTCTGAAGGAAGGCCGGAGGGTGACCCGGTGTGCACGGAGCGTGTGAGTCGGTCCAATTGGCCTGTCATG
GGCCGGATGGCGGATGGATGGAAGCATGCTGACCTGGTGGAATTGCGCAGCATCGATGACATCAACAAGAGCTGCCTGGA
GTCTTTCCACTCGCATTGGCAGTGCCTCGACAACAACAACCAGCAGCTGTGGCAGTGCCGGCCAGAAGAGTGGAAGCTGA
ACAAATGCGTCTTTGAGAACCTGGTGCGTGTTTGTCTTTCCAGGACGCACCTTTGGGACCGTCGTCTGTCTAACTGCCGC
AACAGAATCTGGAGAAGGTCATCCCGGACGCGTCCAAGGGCACGCCCATACATCTCCGCAGCAAGCAGATCTACGCGCAC
TACAACAGAGGCCTTGTCGAGAAGCCCTTTGTGCCGGCAAAGGCACCGGCGACAGAGGCCGCTGCACCGGCGTCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62