GenePrediction:GLEAN_4175 Details

Name: GLEAN_4175
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:424414..423296 (- strand)
Length: 1119
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:424414..423753 (- strand)
Length: 662
Type: CDS
Source: GLEAN
Position: GCSC_160:423686..423296 (- strand)
Length: 391
>GLEAN_4175 class=GenePrediction position=GCSC_160:424414..423296 (- strand)
ATGAAGACTTCTGCCATTCTCGCTCTCTCGGGCTCGCTTCTGGCCATGGCCAGCCCCATCAACAAGCGCGTCTACGAGAC
CGAATATGTCACCGACTTGATCTATGTTACCGTGACTGTCGATCCCTGGACAACCACAACAGTCTATCCCCTGGAACACG
AAACTCCTGAGGTAAAGCACACCACTCTCACTACCGCTGCCCCAGTGACGATTATCACGACAACGAGGGCGCTGCCGCCT
CCGACGACGACATCGACGACTTCTATTGTTGCACCTCCGCCAACAACTTCTTCGACGTCGACTTCCACAACGTTACCTCT
GCCTGTTCCAACAACCTCGACCACAAAATCACCCTTGCCTGTGCCAACTACTTCCACTTCCAAAATTGCAGTCCCAGCTG
TCACCATTGCCGCTGAGGTGACTGTTGCCGCTAAGGTGACTGTTGCAGCCACGCCCTCGACTTCGTCTAAGACCTCAACG
TCGTCTACCTCATCGACAACGGCTGCTGCCGCCACTGCTTCCTCCGATGATTTCCAGACAACTGCTGTCTACCACCACAA
CATTCACCGTGCCAACCACTCTGCTCCTGACTTGAGCTGGAACAGTGACCTGGCCAGCTATGCTGCCACGGTCGCAGCGA
CGTGTGTCTTTGCTCACGATCTGTAAGTTCATGCAACTCGGTTTCAGTTCTAACACCTAATACATGCAATCGCTAACCCA
ATATTCAGGACCCCTGGTGCTTCTACCGGCGCGTACGGCCAGAACATCGCAATGTACGGCTCATCTGATGCTACCGAGAG
CACCTCGTCTTCTTCCGTCATTGCCCAGGCCGTCACCGACATGTGGTACAACGGCGAGGTCTGGCAGTTTCCCGAGGCCG
GCTATGGCGAGGACACCCCCGACATGACCGACTTCGAAGCCTGGGGTCACTTCTCCCAGCTTGTCTGGGTTGCGTCGACT
GAAGTTGGCTGTGCCGTTCAGTATTGTGCTGCTGGCACTTTGGTCTCCGACATGGCTTCCTTCTTCTCAGTCTGCAACTA
CCGCTCAGAAGGTAACGTTGGAGGTAGTTACGGCACCAACGTGCTGAAGTCCCTGGGCAAGGCCTCCGTCACTATCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62