GenePrediction:GLEAN_4176 Details

Name: GLEAN_4176
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:418783..417858 (- strand)
Length: 926
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:418783..418418 (- strand)
Length: 366
Type: CDS
Source: GLEAN
Position: GCSC_160:418349..417858 (- strand)
Length: 492
>GLEAN_4176 class=GenePrediction position=GCSC_160:418783..417858 (- strand)
ATGGCGAGCAAGGCTCAATACACCCAGGCCGCATCGGTCGACCCGGACGAGCATCTCGAGTATACGCAGCCGCCGCCTTC
GTACCAGGCCGAGGCCAGCGCGAGCGCGAGCGCGGCGGCCGACGATGACCAAGAGCGGCTGTTCAGCGGCGCGCCGCGCG
ACAGCGAGGACAACATGCCCGACGACTTCAAATTTGGCGGCTCCGTGGCCGAGGCGACAATCGACATCCGCAACCAGTTC
GTGCGCAAGGTGTATGCCATCCTGACGGTGCAGCTGCTGGCAACCATGGCCCTGAGTGCCGTGAGCTTCTTCAGCGACGG
CTATCGGACCTGGATCCAGAGCCATCCCGGCCTCGTCTTCGTCTCGGTAGGTTCTCTTTCTGTGCATTCGTAATCTTGAG
CTTTACCGGCGCCATTCTGCTAACACTGAGGCAGCTGTTTGGTGCTATGGGCTTCCTGGGCCTCACCTACTGGAAGCGCA
AGTCGTATCCCACCAACCTGTTGTTCCTCGCCGGCTTCACCTTTCTCGAAGCCTACAGCGTCTCCGTGATCGTGTCGTTT
TACAACGCCTCCATAGTCCTCAACGCTGTCGTCCTGACGGCTGGCATCTTTGTCTTCCTGACCCTCTTCGCCTGCCAGAC
CAAATACGACTTCACCTCGTGGATGCCGTACCTCTTCGGCGGCCTCTGGGGACTCATCCTGTTCGGCTTCATGGCCATGT
TCTTCCCGTACAACTCCACTGCCGAGCTCATCTACGGCGGCCTGACCGCCCTCATCTTCAGCGGCTACATTCTCGTCGAT
ACCCAGCTTGTTTTGCGCAAGCACCACATCGAGGAGGAGATTGCGGCTGCTATCAGCCTGTACCTCGACATCATCAATTT
GTTCCTCGCCATTCTGCGCATCCTCAACAGCCAGCAGAACAACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62