GenePrediction:GLEAN_4177 Details

Name: GLEAN_4177
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:414061..412704 (- strand)
Length: 1358
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:414061..413953 (- strand)
Length: 109
Type: CDS
Source: GLEAN
Position: GCSC_160:413894..413794 (- strand)
Length: 101
Type: CDS
Source: GLEAN
Position: GCSC_160:413687..412704 (- strand)
Length: 984
>GLEAN_4177 class=GenePrediction position=GCSC_160:414061..412704 (- strand)
ATGGACGTCCGATCGCCGATCGAGAACTCCAGCAGTTCTGTGGCGCTGTCGGCTTCGTTTAACCTCAATTGTGACTGCTT
TGTCGTAGCCACTAACAATGGCTTCCGAGGTGAGCACAAGTTCACTAGTCGCGGCAGATTACGAGAGCAGGTGCTGATGC
AGTCCAGTCTTTGATGCGGCCACGTGCAAGCAGCTGGCAAAACGAGTCCTGAAAGAAGGCGGTGTTGGCATGATTCAGAT
CTTTGGCCGGTCGAATATCATTCCGCTGGTTGGTGGCAGCAAGCGGCCTGCCAGCGGCCCAACAAAGGCATGGGGTGTCC
CTACTGGTCGAGATGCATCTACACGAGACTGTGCATTGCTAACGATGACCACAGGTGGTCATCTGGGACGAGAAAAAGGT
AGAGTTTACGCGGGAGATTGCCTGCTCGTCTCGCGTGCGCGGCATCCGCGTGCTGGACCGCAAGGTCGTCGTCCTGCTGC
AGGACGAGGTGCGTACCTACAGCATTGACGGCGTACCCAAGCTGGATGCCCGGTTCCCGACGACGTCCAATCCAGCCGGC
CTCTGCAGCATCTCGGGGACACATCTGGCCTTTCCCGGCCGGACGGCCGGCCAGGTGCAGCTGGTGCAGAACCAGACGCA
GGCTGTCAGCATCATCCCGGCGCACGCATCGGCGCTGGGTGCCATCGCCCTGAGCCGCGACGGCTCGCTCCTGGCCACGG
CCAGCGAGAAGGGCACGCTCGTCCGCGTGTGGTCGACGGCCAATAACGCCCGCGTGGCCGAGCTGCGGCGGGGCGTCGAT
CACGTGACCATTTTCTCGCTGGGCTTCAACCCGTCCGGCACGCTGCTGGCCTGCACGTCTGACAAGGGCACGCTGCACGT
CTTTGACGTCCCGCACGCGGGCGGCGGTGTCCTGGACCATCTCCACGGCGGCCCGGCACAGGTGGAGGCGTCGGACGCCG
GCGGCGCGTGGAGCTACGAAGACTCGGACGTGGCCTCGTACGCGAGCGACCCCCGGACGGACGGTGGTCGAGGAGGCGAC
GGGTCTGGCCGCTGGGGCGTGCTCGGCAAGCTGCCGTTCATGCCCAGGTACTTTCGCGACACGGTGTCGTTTGCCAGCGC
CGAGTTCGCCCTGGACGACGGGCCTGGCCCGAATCGGCAGCGCGAGGCCGAAGAGGCAGCCACCATGCGCTGGACCCGTC
TGCCCCGAGGGACTCTCGGCTGGACGAGCGACGACACCGTGGCCGTGCTGGGAGCCGGCATCGATGCCAAGTACGAGCGG
TTCGTGGTGTCGGTCGGTAACGATGGCCGGCGCGTGTGTGTACGACAGGCGTGGGCCAACTACATGGGAATCGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62