GenePrediction:GLEAN_4178 Details

Name: GLEAN_4178
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:410515..407875 (- strand)
Length: 2641
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:410515..410221 (- strand)
Length: 295
Type: CDS
Source: GLEAN
Position: GCSC_160:410151..408535 (- strand)
Length: 1617
Type: CDS
Source: GLEAN
Position: GCSC_160:408473..407875 (- strand)
Length: 599
>GLEAN_4178 class=GenePrediction position=GCSC_160:410515..407875 (- strand)
ATGATGGCAGCACAGCTACAGCGGGCCGGCGGGGCTGCGTCTTCTGGTGCTTCTGGGGTGGCATCCGGCTTGGCCGGGGC
TGCTGCCACAGCTGCTGCAGCAACCGACATGCCGATGCCTGCGACGTCAGAAGAGCCGCCTCTGTGCAGCCGTGTCAGTG
AGAGCAGCAGCCCCTATGTGCGCGCACAAGCGAACACGCCAGTGAACTGGCAGCTTCTCGACCAAGAGGCCATAGACCGT
GCAAAGAGAGAGAACAAGCTGATCTTCCTCAACATCGGCTTCCTTGCCTGTCATTGTGCGTCCCTCACGATCATGTCTGC
ATCCGTGGGTGAAGACGGCCGCTAACTGCCACTTCGTAACACAGACTGCCACACGACGACGCAAGACTCCTTCTCGAGCC
CTGCCGTTGCAGAGATTCTCAACACGTCGTTCATCCCTATTGTCGTCGACCGAGAAGAGCGGCCCGACATCGATGCCATC
TACTGGAACTATCTGCAGCTAGTTAACAGCAGCGCTGGATGGCCCATCAACGTCTTCCTTACCCCCGAACTGGAGCCGGT
ATTTGGTGGGACTTACTGGCCTGGACCGGGGTCCGAGGGCAGCGTCCGGGATGGGCAAGAAGACGGCGGCGAGGACGAGA
TGATCGGCTTTCTCGGTATCTTGAAGAAGCTCCGCCAGTCGTGGACAGACCGCGAGGCGCAGTGTAGAGAAGAGGCCAGA
GAGACTGTGGTACAGTTGCGGAAATTTGCAGCGGAGGGAACACTCGGACCCAGAGGACTGCTCAGGCCGACCGTTGCCGA
AGGAGCACCATACCTCTCACGCGACCTAGACCTCGACATTGACCAGCTCGACGATGCGTATACCCAGCTGAAGAAGACTT
TCGACCCCGTGAACGGTGGTTTTGGTGTCGTCCCCAAGTTTGTCACGCCAGCAAAGTACAGTTTCCTTCTGAAGCTCGGC
AGCTTTCCCAACGTCGTGCAAGGAATCATTGGCGATGCCGAGGCCAAAAACGCCGTGCAGATGGCCCTTTTCACCCTTCG
AAAGCTCCAGGACAGTGGCTTGCATGACCATCTCCGCGGCGGCTTCTCGCGTGCCAGCCATACAATTAACTGGACATTGC
CACACTTTGAGAAGCTCGTCCCTGATAATGCGCTGCTCTTGAGTCTCTACCTGGACGCCTGGCTGTATGGACTGCGCACT
TCTGGAACGGGGGCAAAGGGTACCGATGCTGAGTTTGCAGATGTAGTGTACGCCCTTGCCGACTACCTCTCGAGCTCGCC
GATCCGGCTGGAAGGCGGCGGCTTTGCAAGCAGCGAGGCTGCCGATTCATACTACCGGAGAGGCGACAATCACACGCGCG
AGGGAGCCTACTACGTGTGGACGAGGCGGGAGTTCGATGCCGTCGTGGGCGGACAGAGGAGCGAGAACGACCTCGACACG
CGCGCGGCAGCAGCATATTGGAATGTGCTAGAGCACGGGAACGTCGACCGAGAAGACGACCCCAACGACGAGTTTATCAA
CCAAAACGTGCTTTACGTGAACAAAGACGCGTCAGAGGTGGCGAGACAGTTTGGCATCTCACGCAGCGACGTGTTGCGGG
TTGTCAAGACATCCAAGAAGAAGCTTGCAGCACATCGGGAAAAGGAGAGGGTGCGACCGGCTGCAGATAGAAAGGTGACT
GTGGCCAACAACGGCGTCGTGATCGCGGCACTTGCACGAGTCGGAGCTGTGCTCGTGCACGGCGGCTTTGACCCGGCGAA
TGGCGAAAAGTACATCAGTGCAGCACGGTCAGCGGCCAGATTTATCAAAGCAAACCTATGGGACGTTCAGGACAAATGCC
TCTTCAGAACGTACAGCTACGGGCAGAAGGGAACGAACTGCGGATTTGCCGAGGACTATGCTGTATTGATCGAGGGTCTG
CTGGAACTCTACGAAGCGACGGGCGAGCTAGAGTGGCTGCAATGGGCAGATCAGCTGCAACGTGAGCATTTCTTCCCTCA
TGACAGGCTCGGGCTCGTGGATGCTGACAGACGGCTTTACAGAGAGGCAGATTGAGCAGTTCTACGATGGCGTGGATATG
CCACCCACCAGCAGCCACTCGGCCAGCGGAGGCTTCTACCGCACCAGCGAGCACGAGCCGTTCAACATTCTGCGCATTAA
GGACGGCATGGATACCACGCTTCCTGCGACGAACGGCGTGGCTGCATCCAACCTTTTCCGGCTCGGCAGCCTGCTCGGAG
ACGAGGAGTACTCACATCTGGCCCGCGAAACGATCCACTCGTTCGAGGTCGAAATGCTGCAGCACTCGTGGCTCTTCCCG
ACGCTGCTCTCCCAGATCGTGTCTGCTCGACTGGGCGGACTCCAGTTTGCTTCTGTGGCAGCTGCACCGTCAGCAGCGGA
TCCAGTAGTAGCAGAGTACTTCCGGCGGCCTCGTGCGGGACTGTGCAGCTTGCTTTACGTCGCCCCTGTGGAAGCAAACG
GCACGGACGACGCGATGTCTTGGCTGCGGGCCCGAAACCCTGCTCTGGCTGCTTTGCCGACACATTTGGGTGGAGGAAGT
TATGTATTGCAGAATGGCACTTGGCGAAAGGCAACACTGATCGATCTGACGCAAACAGACGAGGCCAACGAATCAACATA
G

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62