GenePrediction:GLEAN_417 Details

Name: GLEAN_417
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1656079..1657098 (+ strand)
Length: 1020
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1656079..1656115 (+ strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_167:1656181..1656206 (+ strand)
Length: 26
Type: CDS
Source: GLEAN
Position: GCSC_167:1656260..1656388 (+ strand)
Length: 129
Type: CDS
Source: GLEAN
Position: GCSC_167:1656445..1656547 (+ strand)
Length: 103
Type: CDS
Source: GLEAN
Position: GCSC_167:1656648..1656661 (+ strand)
Length: 14
Type: CDS
Source: GLEAN
Position: GCSC_167:1656709..1657098 (+ strand)
Length: 390
>GLEAN_417 class=GenePrediction position=GCSC_167:1656079..1657098 (+ strand)
ATGCGCTTCATGCGGCATGCCGCGAAGGCAAAGGCGAGTGCACTCGATGAATGACTTGACCAAATGGAACGACCGACCGG
GGCTGACCACATCTGAATCTAGTGACGGTTGTCGAGTCGCTTTTGCATGTGAGTCCTGTTGTGTCTTTCTCGCGGGGAGA
CGTATTTTGCTGACTCTCCAGGCCGACCCGAAGCTGGCCCAACGCAAGGACGACGACGGCCGGCTGCCGATCCACTGGGC
AGCATCGTCAAACCAGCTGGAGATTGCCCGCATGTTGGTGCAGATCAAAGGCTTTGACCCGGATGTCCAGGTTTGTCTGC
CTTATTCGGTGTCTGTGCATACAGGCAGACGGCTGACCCGGTCCAGGACGACAGCGGGTGGACGCCGTTGATGATTGCGG
CGAGCGTCAAGGATTCGGAGCCGCTCGTGGAGCTGCTGCTCAGCCGGGGGGCGAGCGTGGATGAGAAGAGTGAGTAGGGA
GAGAGGAAGGAGGAAGGAGAGACGAGAAGGAAAGACGAGAAAGAGAGAGGAAAGAGGAAAAGAGGAAAGAGATTGCTAAC
AGGATGCAGACAATAGTGGACAGGTAGGCTCGCACTCTCCATGGAACGTCGTCCCTCCTAACGCTCGCAGACGGTCCTTC
ACTTTGTCGCCTCCAAGGGCAAGCTCGAGCTGGCCCGCCTGCTGCTCGGCCGCTCGCCGCCGGCATCGGCTCGCGTACGT
GACCGTCGCGGCCAGTACGCGCTGCACCGAGCGGCTGCCGTCGGCTCGGCGCCCATGGTGAATCTGCTGCTGCAGCACCG
CAGCCCGCTCAACGCAACAGACAGCGCCGGCCAGACGGCACTGCACCACGCCATCGCTGAGGGCCATGGCGACACGGCCG
TGGCGCTGCTCAAAGCCGGTGCCGAGACTGACAAGAAGGATGCCGACGGCGCCCTGGCCATGGACCTGGCGCCCGACAAG
GAGGTCCGCAAGTACATCCTCCGCCTGGCCGAGCAGGAGGGCATCGACATCAGCCTATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62