GenePrediction:GLEAN_4180 Details

Name: GLEAN_4180
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:398837..396748 (- strand)
Length: 2090
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:398837..398058 (- strand)
Length: 780
Type: CDS
Source: GLEAN
Position: GCSC_160:397748..397585 (- strand)
Length: 164
Type: CDS
Source: GLEAN
Position: GCSC_160:397429..397158 (- strand)
Length: 272
Type: CDS
Source: GLEAN
Position: GCSC_160:397091..396748 (- strand)
Length: 344
>GLEAN_4180 class=GenePrediction position=GCSC_160:398837..396748 (- strand)
ATGCTCATCCGCGATTTATGCCTCCCTGAGTCTGCTGACTCGCCGACATCTTCAGAGAGCACTTGTGAAAGCATTGCTAC
TACCCCCGTGGAGGAGATAGCTACATCAGAGCAGCGCACGAGCAAAAATGGGTTTATTGCCCCGTTCCCCGCCGGCCAAT
ACTTCCGTCCACCAGAGATGGCTTATAGTTTTGGATACGGCGGCGATGGTCGCTTCCTTCCTGCGATTTCAGACTTGCCG
CGCCGTCTTGGCCCGGCCGATAATAACTTCAACATAAGGACGTCCCAAGTCTCCCAGATGCATGGCATTCAAAGTACGCC
TGTATTTGGATACACAGCTTTCGGTGCCCTGCCTGATTATGAGCGCAAATGGCCGCCGGGGGGACCACCTCATAGGATGC
CAGAGCAAGAGAGACAGCAATATCCTAAAGACCCTTTTGACATTGCACTGCAAATGGCTTCCCAGCGCTGTATCATGGGA
AGACAGAATCCGTTTGGCTGGCCGCCAACTGATTCCCAGCAGCATGTTTTCCAGCAACTGCTTCCCAAGAACCCCGGTAC
ACCGAAGCCAGCAGAAAGAAAACAGGCACCGCCTCGGAAACAACCTTCCAAACAGAAGGCTCCCCGGAAGACCACCCCCA
AGAAGGCACCCTCCGAAAAATCGAAACCTCCTAAGAAACAGGTACAGAAGGGAAAAGCCAAAGAGCAGTCGTCCGAAGTT
TCACCTCGCCTTGAAAAACGTCCCCAGGAGATATTGCAGGAGGGAAGCCCCCATGAGCTTGTTTGTCTATCCCAGAGGCC
GTTGGGCCGACTTAGTATCAATCAGGAACTTCTTCCAGAGGAAGCTCCCCCTCAGAGATCCGCTTCTACAGAGCCAAGCC
CCTGGAATGTAAACCCTCAGGGGTCTCGTCCCCCAAACCAGCGGTCTCTTTCCGAAGGAATGCAGCCTATAAACCCTCTT
TCTCGAACCACTTCCAAACAGCACATCTTACACCCGCCTGCGCATGAACTGAGCCCACCTGATGCTGACCAAGTACATTA
TGATGAAGATATAGATGCAGCTGATTATGTAATCGATCTGACCCAACAGTCTGAAACTGAAGATGCGCCCAGTGGGCAGC
GTATGAGCGACGAGGAGTTAGTGGAACGTTACCGGCAAGAGGCATCCAAGAAGAGGCCAGCAGATGACGACAGCGAGGAC
GATGAAGAGGAAGACGACGAGTCTAGACGCCTTCCAGCCAATTGCGGGATCGGGTACGCTTGTCCATTCTACAAGCGCAA
TCGTCCTAAGTATTTCCCCAAGCGTGCCTGCCGGTCAGCAGGATGGCCTAGTGTCCATCGAGTGAAGTAGGTTGAAGCTG
CGAGCGAGCTTCGTGCGACAAACAGGCAGAAAGCTGACACGTGATCAGGGAGCATCTGTATCGTCACCACATACATATCG
CCTGTGACCGATGTGCGTCGACGTTTCCGAACCGAGACGAGCTGCGGGACCATCTTCGACAGCAGACTCCATGCAAGGTT
TCCGTCCGCAAAGTGGCAGAGGATGCAGGGTTTGGCATTGAAACCGAGAAGAGGCTTCGCTCGCGGAAAAAGTTGGAGGG
CGACAGCGAGAGCGACAAATGGGCGCATATGTTTCGCATACTCTTCCCAAGCTACGAAGGCAAGCCAACGCCATCGCCAA
GTAAGTATCCAGCTCGACCGTCTCTTCAACCGAAGCTGCCATCATGCCGGTTCCTAACCAGTCCAGTTGTCGTCGATGTA
GAAGCAGCGATGTTTGCCCGTGATCTTGTTGCTGCGAAGCTGCAGGAAGCGGGGGATTCTTGTACCTCACTCTTTGCGAC
GGTCCACGAGAGCATTATCAATGCCTTGAACATGGTGACGGCGGTCGCCGAACAGCAACTGCGACTAAGTGAAGGGTCAG
CGGATGTAGATTCGGGCGAGGCGCTGGTTTCTGATGAAACGCAGGCTTTGTACGAGTCATCCATGACGAAGCTGGCGGCG
TTGGCAGAGGAGTTCGAGGCCGCCATGGTCTCTCTTCCGTCTTCTGCTGGCGAAGGCCGCTCAAAGAAGCGTCTCAGGAA
GGAAGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62