GenePrediction:GLEAN_4181 Details

Name: GLEAN_4181
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:395444..393630 (- strand)
Length: 1815
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:395444..395111 (- strand)
Length: 334
Type: CDS
Source: GLEAN
Position: GCSC_160:395042..394929 (- strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_160:394869..394298 (- strand)
Length: 572
Type: CDS
Source: GLEAN
Position: GCSC_160:394234..394030 (- strand)
Length: 205
Type: CDS
Source: GLEAN
Position: GCSC_160:393967..393630 (- strand)
Length: 338
>GLEAN_4181 class=GenePrediction position=GCSC_160:395444..393630 (- strand)
ATGCTGTCCACAGACGAGACGGCACCGCTGCTGGGAACGGCAGAAGATGCTCGGGCAACTGCAGCGATTCCGTCGGACAA
GGACGACGACAAGGGCTGTCGCCTGCCACGCCTCACCACGCGCCAGCTCGCCACCTTGCTGACGGCGCTGGCGATCTTCC
TGGCCGAGCTGACCTTCAACACAATGATGCCGGCCATCAACAGCATGATCGAGGAAATTCTCTGCCGGCAGCTCTACGGC
GACAGCAACACGACAGGTGACTGCAAGGGCGACGATGTGCAGCGCCGTCTGGCCGCCATGCGCGGCTGGCAGACTGCAGG
CGAGTGCATTCCAGGTATGGTTTCTGTCTGTCTCTGACTTCTGTCCATCTGTGTGACTCCCTGTCCCTGACTGACGGACC
AGCCATCCTCTTTACGGTCCCTTACGGCATCATGGCCGACAAGATCGGGCGCAGGCCCGTCGTCCTGCTTGCCTTCAGTG
GCCTGCTTCTCCAGCAGGGCTGGTACCCGATTGTCTGTGCGTCTTCTCCGGCCTGTCCTGTAGCCTCTGTCCCCACTCCC
ATTCACACGTCCAAGACTTCTTCCAAGACACGATGCCGCCCTGGACGATCTACCTCTCTTCCCTCTTCGCCTGCGTCGGC
AGCTTCTCGTCCGTCGGTCCCGCTATGATCCACACCATCCTGGCCGACGTCACACCACAGGCCGAACGGGCGTCCGCTTA
CTTTATCATCGTGGCCACCTTCCTCGTCTCCGACATGATCAGCAGCCCACTTGGTGGCACCTTGCTGCTGTTCGGCAACT
GGGCCCCGCTTCTCGTTGGTGTCGCCGCCGCCGTCCTCGCCGTCCTCGTGCTGCTGCCACTGCCGGAGACGCTCGGCTTT
GATCAGACCACAGGCACTGTTCAGACGGCTGCAAACAGCACCGACACCGACAGCACAGACGGGTCCTCAGCCAAACAGCC
GCTGACCGTGTGGCAGCAGACCGTCCACGTGCTGCGCACCGACGCCCTGGAGACCTGGCGCTTCATCTTCTCCAACCGGC
ACATCATGCTGCTCACGTCGTCCTTTGTCTTCTTCGTCATCGGCCGCTTCGTGCAGGAGCTGCTGCTGCAGTACGCGACG
AAGCGTTACAACTGGTCCTGGAGCCGGGTAAGCCTTCTCTGTTCTTCCCCTTGCTCTATGCCGCTCATCTAACCTCCCTC
TCTCGGACAGGCGGCCTTCCTCCTCACCATCCGCAGCATGTCCAACCTGGTGCTCTTCATCGTCATCCTGCCGGCAGCCA
GCATCTTTTGCTTGCACCGCCTCGGCATGTCGCCCTTGACCAAGGACCTGGTGCTGGCGCGCATCAGCGGCGTGTTCGCC
GTGCTTGGTTCCCTGATGATCGCATTCGCTGTCACGCCTTGGATGCTGTCAATTGGTAGGCGTTTCCCCCGACCTCTTGT
TCAAGGACTTACCGGTGGCCGTTAACACTCCGCCCAGCTCTCATCGTGTTCTCCTTGGGCGGCGGCTTCACCTCGGTGTT
GCGAAGTCTGCTTAGTGCCTTTGTCGAGTCTCATCACCAGGCCATGCTCAACTCGATTATTGGTCTTTTCGAGTTTTCCG
GCCTGATGGTCACCAGCCCCCTACTCTACGGCGCCATGCAACATGGTCTGGAGCTAGGCGGTCTCTGGATAGGCCTGCCC
TTTATGTACGCTGCTGGCATCACCAGCCTGGCCGCTGGCATTGCGTTTGCCTTCCAGATCCCCCCGGTGATGTTAGCGCC
GGCCAGCGAAGCCTCTGGGGCCGAGGAGGAAGGTGTTGGGGACAACTCTACATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62