GenePrediction:GLEAN_4182 Details

Name: GLEAN_4182
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:391544..387333 (- strand)
Length: 4212
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:391544..391504 (- strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_160:391436..388102 (- strand)
Length: 3335
Type: CDS
Source: GLEAN
Position: GCSC_160:387463..387333 (- strand)
Length: 131
>GLEAN_4182 class=GenePrediction position=GCSC_160:391544..387333 (- strand)
ATGGGTATCTTTAGTTTTAAGCGTGGAGGCGACAAGAAGAAGTATGTTGGCCCTTGTTTCCGTTATCAGAGGGCTGCACG
TTGCTAAACATATACCTTGGATGTGCAGAAAATTGGAAAAAGCTGAGGCACAAAAGTCTCCACTACCGAAACCACCGATT
GACCAGAATACTTCCGCCGAAGGCCAGTCCCCCGGCATCCACACCGGTCAAGCCAACAATGGCAACGGCAGCGTCTCCTC
GGGGTCGCCCCGGCTGGGCACCACTGTGCGCGGAACAGAATGGACGGACTCCCCAAAGGTGCCTGCACTAGGATCAACAC
TCGGCAATGCCAGCCTCAGCAGGCTAGATCTGCCGTCGCAGCCTTGGGCTGCTGGCGATGAGCTCGCTCGTCCACGGACA
AGCCACGGGTCCGGTCCAAGCGCGAAGCATAATCTCATCGACGACACCTTTGTCAAAGGCAGCGTTAGCCCACGGTCACG
GTTACGCAGTGCACGCTCGCAACCCAAACTGAACCAAAAGGAAGCTCAACTTAGTATCGACCAGTCTCCCAGTATACCCA
AGTCGCCCTGGTCACCCGTGACTCCTAGCTTTCCAACAGCCAATCCACTAAGCATGCACATCGCCCAGAGCTTGAGTGAC
AACAATCTCTCTGCCATGTCGTCCTCCACCGCAGATGTGTCGGGGCTTTTCGACGTCTCGTCTCTCAGTGCGAATGACTG
CAACGGGTCTCCCGAATCTGTGTCCAGCTTTGCGTCTCCCTCTACGGCCTCTGGAAAAGCAAGGAGACATGGCGCCGACC
CAGCATCTCCACTAGCAGCCAAGTCGGCTGCTGTAGTTGCCACGATAGAGTCTGTTGTGGATGAGCGCAGCCCAGAATCC
TCCGGATGCCGGGCTGAAGACCAAGCGCCCGGCAGTTTTCAGTTGCAGTTCAGAGCGACAGCAGCAGCAGCAGCAAGGCC
ACCGGCAGACATGAGGGCGAGAGATATTGCGAAGCAAAAAGACCTCAGCATCAAGGTACCGCGCCGTAAAAGCTGGTCCA
CAGAGATCAACCAGCTTGAAAAGGCATGGTTAGAGGAACAGCTATCGCCGCGGCTAGCCGCCGAGAAACCGCAACAGCCA
GAGCTACAGCAGCAACGGCAGCAACGCCAACCCTTTGTCGGTACAAACGGAAAAGGTCCATCTCCGCATCAGGAAAACCA
GGCGCGCAATCCCAAGGAGAAGAGCCAGAACATTGGAAAGATGGGCAGTGTTCCTCCAATGCCGCGAACGGACGGCATGA
CACCCTCTCTAGCTCTAAGAGACAACGGCAGGAACAACAGAAACGATTCCGCAGCATGCGGGAATATGCCCCATCACGGC
TTACGAAGCACTTCGTCTCGGACAAACTTGGCCCGAGGCAGTCCTCGGAGCCCACACGATCAGTACTTTCAACACGATCC
CAGGGCTCTTCAGCCCCGACGGGGAAATCCAACACAGCCGCCTCCTCAGCAAGGCCGTCCGCCAGCGAGGGGCCAGTATC
CGCCTCCCCCCGGCCAAGTTGATCCTCGTCTACGTCCGAGAAATCAGGGCCCTAGACCAAGGGTGCCTCCGATACCACGG
CAAAACCCGTTGGGACATCACGATCTGAATTATCATGGCCCTTTTGGGCAAAATGCGCCAAGGACAAGAGGTCTAGCCAG
TCCGCACAGTCCAAACATTCCTTACGGGCCACCCAATTTCCTAAGTGCCCCTGGCACCCATGGGCCTCGTTCTTATGGTC
CGCAGCCTCATGGCCCTCCTCGCCACTTCAACGGTCGCCATCCAAACGAAAATCCTGCCGTGCCAGCAAACTATCACATG
GGCCCGACTGGTTACCGCTTGATGCCGCATCCGTCCGACAGGAAACAGCCCCCGGCCACAGCCCCAGGCTATATCAACAC
CTCTTCCCCGCGGAGTCCAGTAGAACCTAGGCAGCCAGGCTTCCACAATGTCAGTGGACCGATGCGTACCTTACAAACGG
GACAAGCCGGACCAGCACGCAATGCCCTTCCTCCCCGGGACGCATCTCTTGCGCTAGCCAGGTCCCCTCCGATCCTAGTT
CAGGTGCAATCAAACTTTCAAGCAAGCAAGCAAGCAGCTTCTCGGCTACCAACGTCACCAGACGGAGACACTGCCTGTGC
ACTACCACCTGCAAATCTACCTCCAACGCCGGTTTCCCGCAAGAACAGCTTAGAGACCTCCACAGAAGCAACGGATGATA
CACATCAAAGCTCGTCATCGCCTAGTTCACAATCCGAAAAGTCGATTCTGACGGAAGACACAATTGGAAATGACACACTA
GTTGCACAGAGTGAAGCTGTTAATTCTGAGGCGGCCTCCAGCGTTGAGTCTGCCGGGCAAAATAACGACGACAAAGAGCC
ATTTTTCGGTCACCACTTCCGTTCTTTCAACGACACTGACTTGGAGGCAACTGTCGAGAAGTATAGAGAAACCAGGTCAG
AGGTAGAACCTCAAACTGTGCTTAAGCCCGAAATGGAGCCCGAAGTGGAGACTCAAGAAGAGCCTGAGATTGAGCCCGAA
GTACAGCCAAAGACCAAACTTGAATCGGAGCAAGGCAGAGAATTCGGGGCAAAGCTTGAAGAAGGATATGGATTAGAACT
TGAAGCTGAACCCGTGGCAAAATCCGAGGCTGAGTCAGAGACAGAGCCCGAGGTGCAGCTTGAATCGGGTCATGGAATGG
TAGTTGAGATAAAACCAGAACCAACTCCTCAGCTGCGTATCAGCTTGCCATCTCCAACGGCAAACTGGCCGCTCCCCTCA
TTAGGCGCACAAATGGTCGCCGAGTCACCTACGAAGTTTTCTCGGCCAGCTACACCATTGGCTCTTACGCCGGTCAAGTC
AACATTTGCGAGCAGCAGCTCGACTGACAATACGATCAGCGAAGAAGGGGACGGTGAGAACGATATGAGTCCCGCAAGCA
GCGAAATGGGGCTGCCGCCGCCGAGGTCGAAAGCGTTCACTGCCAGCATGTATGCACGAGAGATCGGTGCTGGTCCGTAC
GCCTTCGACACCGGCGACAACAACACGGCGCTCAGCGCGTACGATCTGGAAACAGCCGGAAGCACTCCATGGCTGCCACC
GTTGCGGGAGGACCCAAACGGGGTTTTCCCAGATCCGGTGGCCACGAAGCCAGAAACGATCAGTACGCCGGATATGAGTG
CTAGACATGCTGGTGCCTGGGGTGCAGAGACACCAGAAGATGCTCTCTCGCCCGAATCGATCGGGTTGGCAAGAGGGCTA
TCAATTTGCGCCCCAGGAACCTCGCCGCAGGTGATAATACAGAAGCAGGGGGGACCATCACTGGTCACCGTCGGTCAGGG
TGGCCTAAGTCATGGAAACGGGATGGGACTGAGAACGGCTAATATCGGCTTGGCGATTGGGGGACCAGGACGGGGTCAGG
CAGGTCAGCACACACATACGGGGTTGGTGGACAGTTTTGGGACCGGGTTTATTTGAAGATAGATTGGCGAATCAAAGAAA
GGAAGGTGACGGATGGATGACAGCCTAATGTATATTATTGTGTTCCTGCAACGCCCCGTTACACGGCCAGGCTATCGGAT
TTTACATGTAAGACGAAGTAAATGGTATTGAAGCTTGATATAATTGAAGATGATGCGGCAGAGGCCGCGCAGTAACATCT
CTTGTCCGATATCCTGAGTTGGGTTAAAATTAGGTAATGCCCAGTGATAGATATTGTTGCGGAGAACTGTCTCGTTACAC
TCTGTAGTGGGGGGACAGGCAAGCCTGGCCTCCAGGCCAATATAGGCCCCACAACTATCTGTTATGTGATTGGCCACTCC
TCTCTTTTTTTTTTTTTTCTAGGGGGATTTTTTCGACGTCTATCTCGTCTACAGCGGCAGCTTATATGCTGGACAACGCC
TGCCTTTCTGGGTTCTCTTTTCGCCCATCCATCATCTGCTTTTTTGGCTGACAGCATATACCGACGGAAGCAAGTTTTCA
CGCAGAACGCCACCAGCCTGTGCTCAGCCCTCCGAGCCTTTGGTCAAGCTCGTCTGGACATTACCCTTCCAATTCAATCA
GTTAGCGCAAGGCTCATGTTCAGCCTGCACCACGCCGCCGCCTCGACTTCATTCGCATCGTCGCTTCTTGCCCCGTCGAT
GCACCACAACGAGCCAGATATATTCCATATACCGACGTTTCGCTACTTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62