GenePrediction:GLEAN_4184 Details

Name: GLEAN_4184
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:382802..380839 (- strand)
Length: 1964
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:382802..382712 (- strand)
Length: 91
Type: CDS
Source: GLEAN
Position: GCSC_160:382634..382551 (- strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_160:382391..382329 (- strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_160:382188..381961 (- strand)
Length: 228
Type: CDS
Source: GLEAN
Position: GCSC_160:381614..380839 (- strand)
Length: 776
>GLEAN_4184 class=GenePrediction position=GCSC_160:382802..380839 (- strand)
ATGTCGTACTATGAGAATTCGCGGCCGTGGCCTGCAGTCGGCCAGAATGCTTGGAACGATCTCGACATCGACAGCCAGAC
AGTCCGCTCGGGTTCGTCACGCCATCCCAATGCAGGCTTCTTCAGACCGAGGCTGGCTGGACACTGCAGTGCTGACTAAT
TCATGCAGGTTCGAGCTCTACTGTCCCGACGCAGGGTCTGCCTCCGCCTTCCCAGGGACCGGAGTCGGCCGCCTTTTCAC
ACCAGCTGGAGGGTACGTTATCACGATATTCCGAGCAAGAGGGTCGCATTTGATTTTTGCAAGAGGTGGACGCAGTTCGC
AGCAGCCCTTTGGCAGTCACACCGCAACTATGCAGAAACCGTGATTGAACGCAATGGGAATGCTGACATTTGGATCCCCG
CGCGTCTACAGAGGTTGACAGAGCCATCGACAATCTCGTGAAAAGCGGCAAGATGTTTGGGGTGCCTGGCCGACGTAAGT
GGTTCTCCTTTGTCCAGTTCTGATATCAAGCACCCGAGCGCTTGGTATCGGAACGCTGGCCAGCTGTTTTGCTGCCTGCT
CCACACCTTCAGCATTGTCGTCGGTTGGCATATTGACCCGACTTTTGCACGCAGACGGCCGACAGGCTCACGGCTCAGGT
CCTCGTCCCCACTCGATGGCGGAATTCGGTGACGCGCGCGGCGCGCACCAGTCGAACCTGCAAAACTTCTATGCCAGCCA
GAGGCATCAGTCGTCACGCGGCTCGAGCGACGCAGAACAAATGATTCAGGCCAAGCGAAGGATGGCGGCCCAGCGGGAAC
GAGAACTACGCAACTACCACCAAGAACAGCAATACAATCGAAGTAGGCCGCCCTCCGCTATATAGCGTCACAGTTCCCTT
CATTTTCCTGTTTTCTTATGGCACACGGCACACAAAGGGAGCAAAAACAATGCTCAGGACAAAATCCGGGGAAGGAGGCA
AAATTCGGCCATCACAAGCGATGGCTACGGCCTCGCCGAAGAAAAGAATACTGTTTTTTTTTGTCCAATGCAACTCCTTC
CACTTTTCTGTAGATGTCGAAAGCGCTGTTCTCATTGCTATCTGGAAGTCATCGGATGTGTCGCGTCTCCTTCTCTTGTC
ACCTTCCAAACCTTCGCCCCTTGATGAAAATGAGTTTGCTAACCTTCGTTCTGTTGTCTGAATCACAGCCGTTCTCGCTG
AGCTTTCTTCGTATGGTGGGAAGCCCGATCGTACTCTGAGCCCCGGCAGCATGTCGGAAGCTGATCGTCGTGACCTGATT
GCCCGCCAGCGGAGCGCTTTGTATGGCGAGGGCTCGTTTGCAGAGACCGGAGGCTACGTCGACGAGACGGGCACTTCTCG
GCCAGGTGTGCCTGCAGCTCACCATGGGTCGACGTCGTCTCTTCGCGGCCACTCGCCCCTTGCATATGACTACGGCCGTG
TTCCTCCGGCCGCCGAAGGAGCGGGCGCTCAGGACCCGACGACCGGCTCTCCGTCTGCTGGTGCCAACCAGCGATCTCGT
GCGAACAGCGTGGCAAGCCCTCGGTCGAACACGGGGGAGCAGCAGCAGCAGACGTCGGTGTCGCAGCAGGTGAATCACAC
GAGCACGTCGTCTCCAGGAGCCTCACCGATCAACGGCAAGTCGGGCTCGGGCGGTGCAAGCGGCACAGTTGCGCCCATTG
GTACGCGTCCCTCGACCACAGCGACCTCGGCAGGCGGTGTGGGGACTCCCGGACCAGCGGCTATGAACAAGCGGGCGTCA
ACCCCGCTAGCCTCGCCTCTGGGCTATGGCAGCTCGGGCACGGGCGAGAGTGGCCCAACGACTGGTGGTGGCGTGTCGTC
GAACACGGGTTCGAGCGGCGCAGACGGCCCGATGGGCGTGTCCGGCTGGGGCGGACGCAGTGGAAGCGTATGGGGCAACG
GCAGCAAGCCGGGGATGGGCGTTCAGGCAAGTGTCTGGGGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62