GenePrediction:GLEAN_4185 Details

Name: GLEAN_4185
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:376175..372223 (- strand)
Length: 3953
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:376175..375488 (- strand)
Length: 688
Type: CDS
Source: GLEAN
Position: GCSC_160:375412..375341 (- strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_160:375272..375054 (- strand)
Length: 219
Type: CDS
Source: GLEAN
Position: GCSC_160:374993..372223 (- strand)
Length: 2771
>GLEAN_4185 class=GenePrediction position=GCSC_160:376175..372223 (- strand)
ATGGGGAAAGAAACGGCCCAGAAGGCGGTTGCCGCAGCCAAGCAGAACCAGCACGGCCAAAACGGTCAACACGGCCAGCA
CGGCCAGCACGGCCAGCACGGCCAGCAGAATGGTGCTGCTGACCACCAGCCCCGTGCTGCTGCTGCCTTACGCTCGCAGC
AACAACATCGGCCGTCAAAGTCCCCCAAGCCCCATACCAAAGCCCCGCTGACCCAGGCGAGCTCCGTCCCATCCACGCCG
CACCAGCACGCCCGGAACTTCTCCTTTGAGTCTCGCGAGCCCTCGCCGAATGCAACGCAAAACCACTCGCCGCGGTCTGC
CTACTCCGAGACGAACGTGGCCGTGCCCTCGCTGCGTCCACTGCCTCCACGCTACGGCGGCTGCATCTACGAGACCGCCC
TGGTTCGTGGGCGCCGTCGTATGGCCTACAGCCTCGGCACCGATCGTCTCGAGAACGTCAGCCTTGACAAGATCAAGAGT
CAGCTGTCTGAGGATGAGGAGCAGACGCTGACCAAGGAGATGGGCGAGCTGTATGCCCGGCTAAGACCGAGCGATGAGAA
ACAGGAGCACCGCGAGCGGTTTGTTCAGAAGCTGGAGACGATTTTCAACGAAGAGTGGCCGGGCCACGACATTCGTGTTC
ACATCTTCGGCTCGTCAGGCAACCGGTTATGCTCTGACGACTCTGACGGTAGGTAGCCCCCTTTCCTGATTTTCGTTTCC
GCAACTTTTCCTCGGAACAATCACTAATCTTTCTGTGTGGCAGTGGACATTTGCATTACGACGAAATGGAAGGAGTTGGA
GAATGTGTGCATGATTGCCGAGCTCTTGGCAAAACGTAAGTGCACCCCTTGAGCAGCCTGCTGTTACATGAACCCGGACA
ATATCTCTGACCTACATCAACAGGTGGTATGGAAAAGGTTGTGTGTGTGTCGTCTGCCAAGGTTCCGATCGTCAAGATCT
GGGACCCGGAGCTCAGCCTCGCCTGCGACATGAACGTCAACAACACCCTTGCTCTGGAGAACACACGCATGGTTCTGACC
TATGTCGGAATTGACGAACGCGTACGGCCGCTGGCCATGATCATCAAGTATTGGACGCGACAAAGGATCATTAATGATGC
TGGTACGCTCGGTTTCCTCCCCTCTCCGGCTTCACCGGCAGCCTAGACTAACAAGCGACTAGCTTTCGGAGGAACACTCA
GCTCATACACATGGATATGTATGGTGATCTGCTTCCTTCAGCTTCGAAAAGTCCCCATCCTGCCCTCGCTGCACCAGCGA
CAAGAAGACAAGCTTCCACGACCAGACGGCCAGCTCTCGGACTTTGCCGATAACCTCGGCAAACTACAAGGATTCGGTCG
TGGGAACACGGAGACTTGGGGGCAGCTACTCTTTCACTTTTTCCGCTTCTACGCCTACGAGTTCGACTACGACAAGAACG
TGTTGTCTGTCCGGCAAGGGAAGTTGATGACTAAGACGGAGAAGAAGTGGCACACGGCTCTGAACAACATGCTCTGTGTT
GAGGAGCCCTTCAACACGGTACGCAACCTGGGCAACACGTCGGACGACACGTCATTTCGAGGGTTGCACCAGGAACTGCG
GAGAGCGTTCGGCCTGATTTCGGAGGCCAAGCTCGGCGAGTGCTGCGAGGCGTATGTGTTTCCGAAAGAGGAGGAGAGGG
TTTTCCAGAAGCCATCACAGGCACCACGCCCGGTGATGCTGCGCAGCTCGTCGCAGCAGCATGGCGGCCGGGGTGGACGT
GGCGGTAGCTTCCGGGGTAACAGACAGTACCGCAACGGGAACAACAGCCGGAGGGCCTCTTCAGGCGTGACGTACGACAA
CAGCGCTATGTATATTCAGCAGCCAGCGGCCATGCTGCCGATGCAGTGGTTCCAGCAGCAGCAGGTTGCACAGCAGCAGG
TGCACCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGTCGGGAAACCAGGCACAGCAGCAACAGCAAGCTCAG
CCACAGTACCTCTACCATCCGGACATGTTGGCGGCCCCTCTGAGTGCGCTGCAGCTGCAGCAAGGCTACTCGTTCTACAC
GCAAGCCTTTGTGCAGCAACAGCACGCCCTGGCCCACGCGCAGAGGATACAGCAGCAAGGAGGCTCGCCTTCGGCTACGG
ATCGATCGCGAACAAACTCGTTTGACAACCCGCCTCTGACAACGCCGGTTCGGCAGGACTTGTACATGTATCCGGTGCCG
TTCCAGCAGTCGTTCTTTGCCATGCACCCGGCAGGCTTCACCACGCTGCCGTCGTCGCCGAGCGCCGGAGCACCGGCCGA
GTACCGCAGGAGCTATCGGACGGGGCAGGCGTCTGATGCAGCATCACCCACAGGCACTCTGCGGTCGCAGTCCCAACCAG
CGTCTAGAACACCAATGCCAGGAAGCCAGTCGCACGGAAGCCCGGTGGTTGCTACTCAGCTCAACGGAATCGCGCAGCCC
AACGGCAGCCGAGTGCCAATCAACTTCTTTCCGGACGAAAGTGCGGACTCGGAGGTCGACGATGCAGCCAGCAAGCACGT
GTCAGACTGCCACTCGTCGGAAGAGGAGAACGGGCAGTACGTTGGCTACTACGTCAAGGAGAGCAGCAGCCCGGTGAAGA
CCAGCGCGGCCAACTTGTCGGTCGATATAGCGTTTGGCGACATGGGCCAGTCTGGCGGCAATGGCGGCCATGGGCGCCGC
CGACTGTCAACTGACCTGCCACAGACGGTCCTGGACAGGCGGATGCGACGGGCATCATCGCGGTCACCGTCTCCACTAGG
CCACGGCCGGGCCTTCTCCGTCGGCAACAGCACGATACCACTGCAGGCGGGGCAGTTTCTGCCAGTGATGGGTGCGCGTA
CCAGCAAGGACAGCCGGTCTCCGTTGGTGGTGGACGGGTCGATCAACAAGCCGACGTCGTTGAATCTGTCGAGCCTGCTG
GCCGGCTCCAGCGGACAGAGCACGCAGAGCGGACCTAGTGCGTCGTCGCGCCAGCCGTCGACCAGCGAGAGCGTGATATC
GGAGGAGGCAGCGTCGAGCTCTTTTGCAGGATCGGACATGCTCAGCATGTCGTACACCTCTCACGGACTGGGGATCAGCG
GCCAGGGAATATACTCAGACCAGCCGCTGACGGCAAGCCCGGGACCGCAGCGACAGGCAACGCCGCCGCTGGTCGACACT
CCTCTGCATCTGCCTGTGCCTGGGCGGTCACCTCTGGTGGTGGACGGATCGATATCAGCCGTATCCTCGCCGCGGTCGCA
GCAGACAGCACCGGACACGCAGTCGTTCCACCAGCGCATTGTGGCGATGAACGGATTCAGCTCGGCGCAGTACGCAGCTA
TTGCGGGTTACAGCAACGCCAATGCGGCAGCACAGCTAGCATCATCGACACGGGCGAGGACCATGACGCGGCAGCAGCCG
AAAGGCATCGCGCCCCTGGATCTGGCGCTGCCAGACCACTCGCTGAACGCAGAGATGCAACACCTGTCTCCGGTGTACGA
GCATCGGACGCCGTCGCCGACGGCCGTGCGCCGATTCGACAGTCAGTTCAATCGGATAGCGCAGAGCACAGACGCATTTC
CGGCGGCAGCCGGTGCGTACACAGCGTCCTTTGCTTCGCATGCGAAGAACGTCAAGCACGGGCGAAAAGACACGGCGGTC
AAGGGTGCCGTGAAGGGGGTTCCTGAGGGCAGCACAGGGGTGGCGCAGCCACCGAATCAGCAGCAGACGCAGCCACGGGT
CAACGGGACGAGCGGCGGGGGACAGAACGGCCATGTGCGGTCTGCCAAGAGCGAGAGCGGCGACATGGTGGGTGGCGGGG
CGTGGCAGAAGCCGAAGACGCGGAAGAAGACGGGCGACCTTAAGGCGATGGCGAACGGGCAAGTTTCTGGCGAGCAGCTG
CCAAAGAGCGAGTCGGAACGCAAGGGAGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62