GenePrediction:GLEAN_4186 Details

Name: GLEAN_4186
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:369169..368142 (- strand)
Length: 1028
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:369169..368879 (- strand)
Length: 291
Type: CDS
Source: GLEAN
Position: GCSC_160:368825..368142 (- strand)
Length: 684
>GLEAN_4186 class=GenePrediction position=GCSC_160:369169..368142 (- strand)
ATGCTCACGTCACTACGCAAGCGGCTCAACGGGATGACACTCCCGATTCTGTCCGGGAATAACGGCACAAAGCACGACGC
CACCGAGGCTACAGACGGGGATGGGCCCAGCTTTGCCGACGTCCTTGTGGTGAAGGCTATGATGGGCCAGGCCTTTCATC
TGCCGCTGGAGCTGGTGGACGAGATCGTTGACCTGGCCGAGTACTGGCCACACACCACGACCTGCATCGACTACCGCCAG
ACGGAATTGACAGAGAAGCGGATTGGATCACAGAATCAAAACGTCATGTTGGTGCGTGGAGAGAAGACGAAAGAGAGATT
GGAATGAATGACTGACCAAGACAGTTCCGCACCCCGCCACTGGGCTTCGAGCGCCCGCCGCACGCAGACGAGGCGTCCTA
CACGACGGAGCCACTCGAGCCCGCACAGCTGCAGCAGGAGTACGGCCGCGACGAGCTGGTCCACTGGCTGGGCCGACGAG
CCCCAGCCCTGGAGCATCCATGCCGCAAGATCCGCTTCCGCCTGATCAGCCACGACCAAGGCTGGGGCGGCGGCGGGCCC
AAGAAGGACGAACCCTACAAGGCGTCCTACTCCTGGTTTGACGTCGGTCTGGAGCGGTACGACGCCGTCGATGTGGCTGG
CACGTCTGTCTTGGGCTCCGACACGCCGCCACGCCATCATGCCCTCCGGTCTGTCCAGCCGGCTGTCCGGCCGGCCGAAG
ACGATCCCGTCCAGCTCACCCTCCACCACCCGATGCTGCCGAGCAGCCAGAGGCTGCAGTCGAATCGCACGGCCGTCCGC
ACCGCCACCACACACGACATCACCTGGTCCTGGTTAGACCGGCTGGCCGACGATCCCGCCGCCCGCGACGACCTCGAACG
CCTCGGCCGCGGTCCCGACACCGCCGACGGTGCCTTTGTCCGCGATCTGCGCGTCGGCGACGTCGTCACCCTGTGGGCCA
AGGCCCGCTTCCCCGGCTGGGCCAACGTGGTCGAGCTCGCTCAGGTGGACGTGTACTGGGCCGTATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62