GenePrediction:GLEAN_4189 Details

Name: GLEAN_4189
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:353522..352438 (- strand)
Length: 1085
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:353522..353374 (- strand)
Length: 149
Type: CDS
Source: GLEAN
Position: GCSC_160:353314..352438 (- strand)
Length: 877
>GLEAN_4189 class=GenePrediction position=GCSC_160:353522..352438 (- strand)
ATGCACAACCATTCTGACTCGACGCAGAGGCGGAAGGTGGAGGCCAGTGAAAGCCAAGCCATGGCGTTTAACCCGTCCAC
ACGATTCCAAGCGACAGGAGGGCGGGAATGGACCGTTTCAGTGGCCATCCCGACCAGCATCCTTTCAGAGTAGGTGTTCT
GTCGGAGCTTTTCTTTTCTAGAGCTGTGTGGCTGACACGAAGTCCAAGCTGCACGACGTCGGAGCAGCGGATAAACGCAC
CGTCACGGGTGGCGCGGGCGCTGGCAGCCTTCTCGATCGACGAGCTGGTCATATACGATGACAGTCCGATGGAGTCGCGG
CCCAAGGCAGTCGACCACGACGGCTACACGGGCGACACAGACCCGAGCCACTACCTGTTCCACCTGCTGTCGTACATTGA
GGCGCCACCGTTCATGCGCAAGGCGCTCTTCCCGCTGCACCCGAACCTGCGGCTGCAGGGTCTGTTCCCGAACCTGGAGA
TGCCGCACCACCCACATCGCGACGAGCATCTGCCGTATATGGAGGGCCTCACAGTGGCCGGCAAGCCGGACGCAGGCCAC
AAGACGCTCGTCGAGCTCGGGTTGCGCAAGCCAGTGTCGATCAAGGAGGAGATTCCGGTCAAGACGCGGGTGACGCTCCG
GTTTCCGCGCGAGTCGTTTGAGGACGGCGAGGCTGTCGATCCGGCCGCGCCACGCACCGAAGCCGGCTACTACTGGGGCT
ACCAGCTGCGGCAGTGCTCCTCGCTCTCGGCCGTCTTCACCGAGAGCGCGTACGAGAACGGCTATGATGTGAGCATCGGC
ACGTCTGAGCGCGGCTTGCCGACGTCGCAGGTGTTTCCGCGCGCCACCACCGGCACGCTCGACTTCCAGCACCTCATCGT
CGTCTTGGGCGGCCCGCGTGGGCTCGAGTATGCGGCCATGAACGATCCCGACCTCGCCGGCGTCGGCATCACCAAGGCCA
ACGTGCGCGAGACCTTTGACCACTGGGTCAACGTGTTGCCAAACCAGGGCACGCGCAACATCCGCACCGACGAGGCCGTC
TTCATCGCCCTCATGGACCTGCGTCGGCTATGGTCCGACGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62