GenePrediction:GLEAN_418 Details

Name: GLEAN_418
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1661326..1662631 (+ strand)
Length: 1306
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1661326..1661409 (+ strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_167:1661489..1661675 (+ strand)
Length: 187
Type: CDS
Source: GLEAN
Position: GCSC_167:1661744..1661883 (+ strand)
Length: 140
Type: CDS
Source: GLEAN
Position: GCSC_167:1661936..1662116 (+ strand)
Length: 181
Type: CDS
Source: GLEAN
Position: GCSC_167:1662175..1662321 (+ strand)
Length: 147
Type: CDS
Source: GLEAN
Position: GCSC_167:1662477..1662631 (+ strand)
Length: 155
>GLEAN_418 class=GenePrediction position=GCSC_167:1661326..1662631 (+ strand)
ATGTCGTGGTTCCAGCTACCCTACCGTGAGGCTCGTGATGGCTTCTGGGGCGAGCAGACGTCCACGCTCAACTGGTGTGA
AGAGGTATGAACCTCTCTGCTTTCTGCTTTCTGCTGCGGCCATTGGCTTCTCCTCCGCGCTGCTGACACCACGGCACGCC
CAGGACTACAACATCACCCACTACTGTGCCGAGCTCGTCAACACCCTGACCAACCTTACCTTTATCTGGCTTGGGGTCAG
CGGCATCCGCGACTGCATGCGCTTCTCACACCCGAGCATCTTCTTCGTCGCCTTTGCTGGATACATCATTGTTGGCATGG
GGTCCATGGCCTTTCACGCCACTCTTAAATGTCTGTTCCAGCCGATCCGGGCCACCCCTGCTCTCCACCCCCTTTGCCAT
GCTGACACGTGATGGCAGACTCCATGCAGCTTGCCGACGAGCTGCCAATGATCTATGCGACGTGCATCATAGGGTATGCG
ACGTTCTCGTTTGGCAAGAGCCGCGCCCTCCAGACGGTCGTGGGCCTGTCTCTGTTCAGCCTGGCCCTCTTCATCACGGT
TCGTGCTGGTGCTGCTTTGTTTGCGACCTGTCGGACTAACCAGGACACAGGTCGTCTACTACATCACCAAGGATCCCGTA
TTTCACGAGGTGTCGTATGGCGTGCTCACGGCAGCCATCGTGTTCCGTGCCATGTTCATCATGAAATACCAGCTGCACCC
GGCCTTGGAGCTTCGCAGCACAGATCGGGCAGCGGCCATCATGTCGCAGATGTGGAAGATGTGCTTCACCGGTCAGTTTT
CCCCAGCGACCGGCTCTTGCTTGTTGTCTCGCATGCTCACCATCTCAAGGCATCGGGATGTTCCTTCTCGGCTTCCTGAT
CTGGAACCTCGACAATGTGTACTGCAGCCACCTTCTGTCGTGGCGGCAGATCCTGCTTCTGCCATGGTCTCTTGTCCTCG
AGGGCCACGGCTGGTGGCATCTCTTTACCGGGCTAGGTAGGTACACCAGGGCGCCATTTTTTTGTGGTGCACAGCTGACA
TCGTACAAGGTGGTACGTTTATGCCGATTGGGCCGAAGAGCCGACCAGACAGCAGATCGAATTTTGTGTTTCCCCTTCTC
CCCGCCCGTGATTTCTTGCTAACAGTAGCAGCGTACTACTTTATTGCTTGGCGTATCTGGTTGCACCGATGTCTTGAAGG
TAAAGAAGACGAGTACATGCTGCAATGGCCGTCACCGTATACGTCGGTGCCGCGTGTGGTCCCGATTTATGAAGGGGACA
ACGGCAAGGACCGAAAGATCCTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62